ID: 902990541

View in Genome Browser
Species Human (GRCh38)
Location 1:20184644-20184666
Sequence CATTAGAACTGGAGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 339}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902990532_902990541 16 Left 902990532 1:20184605-20184627 CCCATGGAGGAGCAATTCACCTT 0: 1
1: 0
2: 0
3: 10
4: 96
Right 902990541 1:20184644-20184666 CATTAGAACTGGAGGGAGGGAGG 0: 1
1: 1
2: 2
3: 31
4: 339
902990533_902990541 15 Left 902990533 1:20184606-20184628 CCATGGAGGAGCAATTCACCTTG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 902990541 1:20184644-20184666 CATTAGAACTGGAGGGAGGGAGG 0: 1
1: 1
2: 2
3: 31
4: 339
902990535_902990541 -3 Left 902990535 1:20184624-20184646 CCTTGGAGAGAATCAGAAGACAT 0: 1
1: 0
2: 1
3: 31
4: 275
Right 902990541 1:20184644-20184666 CATTAGAACTGGAGGGAGGGAGG 0: 1
1: 1
2: 2
3: 31
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902990541 Original CRISPR CATTAGAACTGGAGGGAGGG AGG Intergenic
900246514 1:1638626-1638648 CATGCCAGCTGGAGGGAGGGCGG + Intronic
900257742 1:1705768-1705790 CATGCCAGCTGGAGGGAGGGCGG + Intronic
900640121 1:3684512-3684534 CCTGAGCACTGGAGGGAGTGGGG + Intronic
901337084 1:8459392-8459414 ATTTAAAACTGGAGGAAGGGTGG + Intronic
901922836 1:12548651-12548673 CATTGGAGAGGGAGGGAGGGAGG + Intergenic
902155540 1:14482627-14482649 CATTAGAAAGGGAGGGAGTTGGG + Intergenic
902990541 1:20184644-20184666 CATTAGAACTGGAGGGAGGGAGG + Intergenic
904514519 1:31043861-31043883 CATTAGAAATGGGGGATGGGAGG - Intronic
904902383 1:33867717-33867739 AATTAGCACTGGACGGTGGGAGG - Intronic
905025930 1:34849432-34849454 CATTAGAACAGGAGGGAGCAGGG + Intronic
905339070 1:37265975-37265997 CATTTGAGCTGGAGGCAGTGGGG + Intergenic
905582668 1:39094077-39094099 CATTAGAAGTGGAGTGGGGTGGG - Intronic
905731659 1:40302802-40302824 CAGTTGCTCTGGAGGGAGGGAGG + Exonic
907066729 1:51491745-51491767 CTTTAGAACTGGAGAGGGTGGGG + Intronic
907575407 1:55521697-55521719 CATCAGAACTAGGGGGAGGGAGG - Intergenic
907643297 1:56214459-56214481 GATTGTAACTGTAGGGAGGGAGG - Intergenic
907824251 1:58000043-58000065 AGTGAGAAATGGAGGGAGGGAGG + Intronic
908497462 1:64709049-64709071 CATGAGATTTGGAGGCAGGGGGG - Intergenic
908597419 1:65703369-65703391 CATGAGAACTGTAGGCAGGATGG - Intergenic
909691942 1:78418909-78418931 CATTAAAAATGCAGTGAGGGAGG - Intronic
909928978 1:81473062-81473084 AATTAGAGATAGAGGGAGGGAGG + Intronic
910766172 1:90784624-90784646 CATTAGCATTAGAGGGAGGGAGG + Intergenic
913532095 1:119740659-119740681 CCTTACTACTGGTGGGAGGGTGG + Intronic
915532166 1:156508956-156508978 CATCAGCAGTGGAGGGAGGTGGG + Intergenic
917072963 1:171172824-171172846 CATAGTAACTGGAGGCAGGGTGG - Intergenic
917539352 1:175898179-175898201 CATTGGAGCTGCAGGGAGGGAGG + Intergenic
918025857 1:180745309-180745331 CAGTGGAACAGGAGGGAGGGAGG + Intronic
918441975 1:184576717-184576739 CATGAGAACTGGAGGTAGGGAGG - Intronic
918828038 1:189352975-189352997 CATTATTACTGGGGGCAGGGAGG - Intergenic
919600516 1:199616543-199616565 CCTCAAAACTGGGGGGAGGGGGG + Intergenic
920521522 1:206630962-206630984 CATTAGATCTGGTGGGATGGAGG + Intergenic
921493969 1:215813359-215813381 GATTAGAAATGGAGGAAGTGGGG + Intronic
922063658 1:222115458-222115480 CATTAGAAAAGGAGGGAGGAAGG - Intergenic
922210652 1:223483981-223484003 CATTAGAGCTTGGGAGAGGGAGG + Intergenic
922443061 1:225672604-225672626 TATTAGAACTGGAAAGAGGCTGG - Intergenic
922635550 1:227166879-227166901 CATTCAAACTTGGGGGAGGGGGG + Intronic
922869791 1:228892928-228892950 CATTTGAGGTGGGGGGAGGGGGG - Intergenic
924094701 1:240539239-240539261 CATTATAACTGCAGCGAGGCAGG - Intronic
924200241 1:241650989-241651011 CATTAGAATTGTAGGAAGAGTGG + Intronic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
1063365357 10:5487136-5487158 GATTAGGACAGGAGGGAAGGTGG - Intergenic
1063435577 10:6027019-6027041 CCTAAGAACTGAAGGTAGGGAGG + Intronic
1063572826 10:7231998-7232020 TTTTAAACCTGGAGGGAGGGAGG + Intronic
1063849018 10:10163265-10163287 CATTAGAGCTGATGGGAAGGGGG + Intergenic
1064823131 10:19362384-19362406 GATTAGATTTGGAGGGAGTGAGG - Intronic
1065955575 10:30690886-30690908 CAGTAAAACGGGAGAGAGGGAGG - Intergenic
1066333391 10:34449447-34449469 CATTGGAGGTGGGGGGAGGGGGG + Intronic
1067833099 10:49621540-49621562 CATTAGTACCGGGGGGTGGGAGG + Intronic
1067993527 10:51242942-51242964 AATTAGATTTGGAGGGAGGCTGG + Intronic
1069998344 10:72357174-72357196 TTTTAGAAAAGGAGGGAGGGGGG + Intergenic
1070714155 10:78706579-78706601 CATTAAAAATGGAGGCAAGGAGG + Intergenic
1070843333 10:79503184-79503206 CAAGGGAGCTGGAGGGAGGGAGG - Intergenic
1071302947 10:84270650-84270672 CATTAGAACTGGGGGAAGGCAGG - Intergenic
1071410205 10:85384011-85384033 CATTAGAAATAAAGGGATGGAGG + Intergenic
1072382495 10:94889930-94889952 AATGAGAACAGAAGGGAGGGTGG - Intergenic
1073110775 10:101061893-101061915 CCTTAGAACTAGTGGGAAGGCGG + Exonic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075618995 10:123911976-123911998 CTTTAGAACAGAAAGGAGGGGGG + Intronic
1075936109 10:126342896-126342918 GATGAGGGCTGGAGGGAGGGTGG + Intronic
1076263411 10:129090243-129090265 CATTGGGACTGGAGTGAGGGTGG + Intergenic
1076516498 10:131048012-131048034 CACTTGAACTGGGGGCAGGGAGG + Intergenic
1076631288 10:131853576-131853598 CAGGAGAAATGGAGGGAGAGGGG - Intergenic
1077782094 11:5341999-5342021 CATTATAATTTGATGGAGGGAGG + Intronic
1079962397 11:26940710-26940732 CATGAAAACAGGTGGGAGGGAGG - Intergenic
1085056314 11:73406117-73406139 CTTTAGAATTTGGGGGAGGGTGG - Exonic
1085529707 11:77184116-77184138 CATAAGAACTGGTGTGAGGCTGG + Intronic
1087151220 11:94861482-94861504 CATTAAAATTGCAGGGAGGAAGG - Intronic
1088103048 11:106175945-106175967 GATAAGAACTGGAGGTTGGGTGG - Intergenic
1088140748 11:106613237-106613259 AATTGGGACTGGAGGTAGGGAGG + Intergenic
1088551690 11:111019780-111019802 CACTTGAACTGGAGAGAGGCTGG - Intergenic
1089015512 11:115162166-115162188 CAGTAGAAGTGGCGGGAGGAGGG + Intergenic
1089180183 11:116578238-116578260 AAGAAGAAATGGAGGGAGGGAGG - Intergenic
1089764448 11:120752651-120752673 CCTGAGAGCTGCAGGGAGGGTGG - Intronic
1089971311 11:122695714-122695736 CATTAGACCTCCAGGGAGTGAGG - Intronic
1090824869 11:130377710-130377732 CATTAGAAAAAAAGGGAGGGTGG + Intergenic
1091567015 12:1656212-1656234 CATTGGACCTGGAGTGAGTGTGG + Intergenic
1092083419 12:5736540-5736562 CTTGGGCACTGGAGGGAGGGAGG - Intronic
1092332072 12:7594036-7594058 CATTAGAACTGGTTGGACAGTGG + Intergenic
1092917495 12:13201981-13202003 AACTAGGACAGGAGGGAGGGAGG + Intronic
1094276607 12:28684343-28684365 AATTAGAAGTGGAGGAAGTGTGG - Intergenic
1094423758 12:30298359-30298381 CTTCAGAGCTGGAGTGAGGGTGG - Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096003350 12:48148095-48148117 CAATACAATTGGTGGGAGGGTGG - Exonic
1096084577 12:48857225-48857247 CTTTGGAATTGGGGGGAGGGGGG - Exonic
1096628443 12:52909846-52909868 TATTAGAACAAGAGTGAGGGAGG + Intronic
1096969212 12:55651956-55651978 CATTAAAACAGCTGGGAGGGGGG + Intergenic
1097421573 12:59387428-59387450 CATTAGACATGGATGGAAGGAGG + Intergenic
1099674612 12:85742780-85742802 CATGAAAACAGCAGGGAGGGAGG - Intergenic
1101654598 12:106708782-106708804 TATTAGAACAGGAGGCAGGAAGG - Intronic
1101696798 12:107134673-107134695 CACAAGAACTGGGGGGAGGAGGG - Intergenic
1103219200 12:119229421-119229443 GATTAGAACTGGGTGGTGGGTGG + Intergenic
1104595019 12:130115074-130115096 CATGGGAACTGGAGGGAGAGAGG - Intergenic
1104917370 12:132272821-132272843 CCTGCGAAGTGGAGGGAGGGTGG - Intronic
1104984121 12:132587097-132587119 CAGTGCAGCTGGAGGGAGGGCGG + Intergenic
1104984147 12:132587208-132587230 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984183 12:132587364-132587386 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1105073613 12:133254218-133254240 TATGAGAACTGGAGTGAGGACGG + Intergenic
1105694408 13:22873592-22873614 CAAAAGGAATGGAGGGAGGGAGG - Intergenic
1108726465 13:53188254-53188276 CATTAGAAATGCAGGCTGGGGGG - Intergenic
1109334223 13:60971783-60971805 CATGAGAACAGAAGGAAGGGTGG - Intergenic
1112155361 13:96811005-96811027 CATTGGAGTTGGGGGGAGGGGGG - Intronic
1113648100 13:112012983-112013005 CGTTGGAACTGGAGGGGGGCAGG - Intergenic
1114544768 14:23491041-23491063 AATTAGAACTTCCGGGAGGGAGG - Intronic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115776341 14:36719608-36719630 TATTAGAGTTGGAGGAAGGGTGG + Intronic
1120218838 14:81710077-81710099 TATCAGAATTGGAGGGAGTGTGG - Intergenic
1120827761 14:88970601-88970623 CTTTAAAACAGGAGGGAGGCCGG + Intergenic
1120994430 14:90405814-90405836 CATTTTCACTGGGGGGAGGGGGG + Exonic
1121398043 14:93644820-93644842 CAAAAAAACTGGAGGGAGGGAGG - Intronic
1121971296 14:98358845-98358867 CAGTAGAAATGGAGAAAGGGTGG - Intergenic
1122202168 14:100129269-100129291 CATGACACATGGAGGGAGGGAGG - Intronic
1122428195 14:101623770-101623792 CCTAAGCCCTGGAGGGAGGGAGG - Intergenic
1122775794 14:104116585-104116607 AAGTGAAACTGGAGGGAGGGAGG - Intergenic
1124646922 15:31443824-31443846 CAATGGGACGGGAGGGAGGGAGG - Intergenic
1126180356 15:45779285-45779307 CCTTAGAACTTGAAGGAGAGGGG + Intergenic
1126476271 15:49068662-49068684 CATTGGAACTGGCTGGACGGTGG + Intergenic
1126558006 15:50011582-50011604 CCTTTGAACTGGGTGGAGGGTGG - Intronic
1126801722 15:52304083-52304105 CATGAAAACAGAAGGGAGGGAGG - Intergenic
1128442446 15:67724727-67724749 CATTAGACCTAGAGGGATAGAGG + Intronic
1128593741 15:68926266-68926288 CATTCTAACTGGAGGGATGATGG + Intronic
1129313966 15:74729931-74729953 CACTAGAACTAGAGGCAGGCAGG - Intergenic
1129525583 15:76211835-76211857 CATTGGGACTGGTGAGAGGGAGG - Intronic
1129572863 15:76708439-76708461 TATTAGAAATGCAGGGAGGGTGG + Intronic
1131855596 15:96590313-96590335 GATTAGGACTGGAGTGAGGGAGG + Intergenic
1132272583 15:100539335-100539357 CATTAGTACTGCAGAGAGTGGGG - Intronic
1132890806 16:2203658-2203680 CATCAGAGCTGGAGACAGGGTGG + Intergenic
1133969545 16:10557896-10557918 CATCAGAACTGGAGAGAGTGGGG + Intronic
1134754021 16:16650613-16650635 CAGGAGAAAGGGAGGGAGGGAGG - Intergenic
1134992038 16:18708431-18708453 CAGGAGAAAGGGAGGGAGGGAGG + Intergenic
1137540187 16:49356522-49356544 CATGAGACCTTGAGGCAGGGAGG - Intergenic
1137699937 16:50490214-50490236 CATGGGCACTGGAGGGAGGATGG + Intergenic
1139085205 16:63576467-63576489 CGTTATAACTGGAGGGAGTCAGG - Intergenic
1139283976 16:65794294-65794316 CATCAGAACTGAAGAGAGAGGGG + Intergenic
1139313934 16:66051366-66051388 CATTTGGGCTGGAGGGAGGGAGG + Intergenic
1140161569 16:72500892-72500914 TATTTGAAGTGGGGGGAGGGAGG - Intergenic
1140728320 16:77833822-77833844 CATTAGAAGTGGAGGTGGGCTGG + Intronic
1141265122 16:82489634-82489656 CATTACAACTAGAGGCAGGTTGG - Intergenic
1141888147 16:86907341-86907363 ATTTAGGGCTGGAGGGAGGGTGG - Intergenic
1143504590 17:7356645-7356667 CCTTAGAGCTGGAGGCTGGGAGG - Exonic
1143532915 17:7516120-7516142 CCTGAGAACTGGAGGTGGGGTGG + Intergenic
1143895866 17:10135748-10135770 CCTCCGAACTGGGGGGAGGGGGG + Intronic
1144002001 17:11063856-11063878 CATATGAATTTGAGGGAGGGGGG + Intergenic
1144130686 17:12243637-12243659 CAGAAGAAATGGAGTGAGGGTGG + Intergenic
1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG + Intronic
1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG + Intronic
1146475500 17:33159462-33159484 CAATAAAACGGGAGGGAGAGGGG - Intronic
1149289257 17:55200013-55200035 CTTTACAACAGGAGGGAAGGTGG - Intergenic
1149395619 17:56239243-56239265 CATAAGAAATGGAGAGAGGTTGG + Intronic
1149399018 17:56274859-56274881 CATTAGATTTGGAGGCAGGCAGG + Intronic
1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG + Intronic
1150288503 17:63967633-63967655 CATAAGAAGTGGAGACAGGGCGG + Intronic
1151200901 17:72467488-72467510 CTTTAGAACTGGGGAGAGGGAGG + Intergenic
1151678000 17:75609707-75609729 CATCAGGAAGGGAGGGAGGGAGG - Intergenic
1153635681 18:7110886-7110908 AATTAGAAGTGGGGGGGGGGAGG - Intronic
1154219692 18:12441158-12441180 CACTTGAACTGGAGGGAGGGGGG + Intergenic
1154309941 18:13259696-13259718 CAGCACAAATGGAGGGAGGGAGG - Intronic
1155283226 18:24262704-24262726 CATGAGAACTTGGGGGAGAGAGG - Intronic
1157236213 18:45967414-45967436 CATTTGCACTGGAGGAAGGCAGG + Intergenic
1158200707 18:54936581-54936603 CATGAGCACAGGTGGGAGGGAGG - Intronic
1158701724 18:59754440-59754462 AATGAGAACTGCAGGGAGCGAGG - Intergenic
1158739865 18:60128141-60128163 AATGAGAAATGGAGGTAGGGAGG + Intergenic
1161062339 19:2221580-2221602 TCTGAGAACAGGAGGGAGGGAGG + Intronic
1161452183 19:4352761-4352783 CATGACCACTAGAGGGAGGGAGG - Intronic
1162728992 19:12706360-12706382 CAAAAGCACTGGTGGGAGGGAGG + Exonic
1163637721 19:18445163-18445185 CATGGGAGCTGGAGGGAGGAGGG - Intronic
1166401768 19:42486782-42486804 CATTTGAACTGGAAAGACGGAGG - Intergenic
1166939126 19:46352279-46352301 CATTAAAATGGGAGTGAGGGTGG + Intronic
1166966024 19:46529649-46529671 AATAAGAAGGGGAGGGAGGGTGG + Intronic
1167221830 19:48204299-48204321 CCTGGGAACTGGAGGGATGGAGG + Intronic
1167508961 19:49885889-49885911 CACTCGAACTGGAGTGGGGGAGG + Intronic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1168394644 19:56037834-56037856 CATGAAAACCTGAGGGAGGGAGG + Intronic
925221346 2:2143956-2143978 TATTAGAGGGGGAGGGAGGGAGG + Intronic
925467689 2:4123615-4123637 AAAGAGAAATGGAGGGAGGGAGG - Intergenic
925520975 2:4745750-4745772 CATTAGCACTGAAAGGAAGGCGG - Intergenic
925816982 2:7763401-7763423 CATTAGAGCAGCTGGGAGGGAGG - Intergenic
926078025 2:9958040-9958062 CATTTGATCTGAATGGAGGGTGG + Intronic
928680698 2:33699675-33699697 CATTGGGACTGGACAGAGGGAGG + Intergenic
928939619 2:36714526-36714548 CCATGGCACTGGAGGGAGGGGGG + Intronic
929175592 2:38972254-38972276 GATTTGAACTGGAGGTAAGGGGG + Intronic
929600531 2:43201628-43201650 CAGTTGAACTGGTGAGAGGGAGG - Intergenic
930880074 2:56260313-56260335 AGCTAGAACTGGAGTGAGGGTGG + Intronic
931804047 2:65787815-65787837 GATTAGATATGGAGGGTGGGGGG - Intergenic
931953676 2:67394467-67394489 GATTAGAAGTGGACAGAGGGAGG - Intergenic
932743550 2:74312165-74312187 GATTAGAAGTAAAGGGAGGGAGG - Intronic
932782496 2:74569674-74569696 CAATAGAAGTAGAGTGAGGGAGG - Intronic
933658409 2:84907164-84907186 CACTAGAACTGGGGGAGGGGAGG + Intergenic
935451288 2:103212725-103212747 CCTGAGAACAGGAGGGAGAGAGG - Intergenic
937621236 2:123990054-123990076 CATTAGAACTTGGGGGAAGATGG + Intergenic
937920105 2:127122730-127122752 GAGGAGAGCTGGAGGGAGGGGGG + Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938655582 2:133429482-133429504 CAGTAGACCTTGAAGGAGGGAGG - Intronic
939208170 2:139134674-139134696 CTTGAGAACTGCAAGGAGGGTGG - Intergenic
939480593 2:142742832-142742854 CATTGGGGGTGGAGGGAGGGGGG - Intergenic
941695533 2:168547342-168547364 CATTAGAACTTGAGGATTGGAGG + Intronic
941767643 2:169315751-169315773 CCACAGAACTGGAGGCAGGGAGG + Intronic
944652712 2:201847785-201847807 CATTAGAACTGGAGGTAGCAAGG - Intronic
945022061 2:205583830-205583852 CAGTAGAACTGGAGGTGAGGTGG - Intronic
948335665 2:237205073-237205095 CACCAAAAGTGGAGGGAGGGAGG + Intergenic
948737974 2:240022620-240022642 AATAAAAATTGGAGGGAGGGAGG + Intronic
1170103412 20:12727205-12727227 CTTTAGAGCTGGGTGGAGGGAGG - Intergenic
1170906235 20:20517276-20517298 CATTAGGACAGGAGTGAGGCTGG + Intronic
1170985186 20:21251464-21251486 CATTAGAAATGGGGGGAGGAGGG - Intergenic
1171099419 20:22368585-22368607 CATGAGACCTAGAGGGAAGGAGG - Intergenic
1172591150 20:36119171-36119193 GATTAGTACTGAAGGGAGGTGGG + Intronic
1172893998 20:38286731-38286753 CAGAAGAAGTGGATGGAGGGTGG + Intronic
1173283093 20:41646592-41646614 CATTAGTACTGTAGGGAGGATGG + Intergenic
1173374452 20:42470905-42470927 CATTAGAAATGGGGGTATGGAGG + Intronic
1173401165 20:42727195-42727217 CATTGGAACGGGGGGGATGGAGG - Intronic
1174359343 20:50018082-50018104 GAGTAGGAATGGAGGGAGGGAGG - Intergenic
1174678470 20:52380934-52380956 CATTAGAAGTGGAAGGATAGAGG - Intergenic
1175118697 20:56702231-56702253 CTTTAGAAGTGGGGGGTGGGGGG - Intergenic
1175258885 20:57662805-57662827 CATCAGCCCTGGAGGGAGGGAGG + Intronic
1175381497 20:58567352-58567374 GATTTGAACTGGAGGGTGTGGGG - Intergenic
1175610632 20:60348186-60348208 CATTAGAAGTGGGCAGAGGGTGG - Intergenic
1175836494 20:61999203-61999225 CATTCAGACTGGACGGAGGGAGG - Intronic
1178033197 21:28551711-28551733 TATTAGGACTGGGAGGAGGGGGG - Intergenic
1178339819 21:31776866-31776888 CATTAGAAATCCAAGGAGGGGGG - Intergenic
1180151561 21:45950801-45950823 CAACAGGGCTGGAGGGAGGGAGG - Intergenic
1180226515 21:46396463-46396485 CATTAAAACTGCTGTGAGGGTGG + Intronic
1180978390 22:19864692-19864714 TATTAGAGCTGGGGGAAGGGAGG + Intergenic
1181597369 22:23925103-23925125 GATTAGAGCTGGTGGGAAGGGGG - Intergenic
1182751202 22:32643537-32643559 AATTAGAAATGGTGGGGGGGCGG + Intronic
1183031310 22:35108406-35108428 CATTACCACTGGAGGGGGTGGGG + Intergenic
1183160598 22:36110525-36110547 GATTTGGACAGGAGGGAGGGAGG + Intergenic
1184292741 22:43506727-43506749 AATTAGGACTGGAGGGGGTGGGG + Exonic
950106405 3:10391756-10391778 GATTGGAACTGGAGGGAGACAGG - Intronic
950811784 3:15656248-15656270 GATTAGAACTGATGGGAAGGGGG - Intergenic
951150061 3:19278133-19278155 CATTAGAAATGCAGGGTGGAGGG + Intronic
952190985 3:31023474-31023496 CAGTGGAACAGGAGGAAGGGAGG - Intergenic
952253156 3:31673608-31673630 CATTAGTGCTGTGGGGAGGGTGG - Intronic
952421340 3:33134114-33134136 TCTTAGAACTGGGAGGAGGGAGG - Intronic
953831923 3:46306536-46306558 CACTTGAACTGGGGAGAGGGAGG - Intergenic
954030977 3:47819781-47819803 CATTGGCAGTGGAGGAAGGGGGG - Intronic
955472697 3:59302501-59302523 GAGTAGAACTGGGGGGATGGGGG - Intergenic
955951888 3:64250888-64250910 GTTTAGAACTGGAGGAAGTGAGG - Intronic
959081484 3:101806363-101806385 CATTAAAACATGGGGGAGGGTGG - Intronic
959327640 3:104957142-104957164 CATCACATGTGGAGGGAGGGAGG + Intergenic
961390654 3:126550655-126550677 CATGAGCACAGGAGGTAGGGAGG - Intronic
961558292 3:127711579-127711601 AATTAGAATTGGACGGAAGGTGG + Intronic
962221314 3:133566663-133566685 AAATAGAACTGGACTGAGGGTGG - Intergenic
962736818 3:138332873-138332895 CATTACACCTGGAAGGAGAGAGG - Intergenic
965322441 3:167266426-167266448 GATTAGAACTGACGGGAAGGGGG - Intronic
965323484 3:167274639-167274661 GATTAGAACTGACGGGAAGGGGG - Intronic
969159058 4:5239354-5239376 CAATAGAATTGGAGGCAGGCAGG + Intronic
969439961 4:7211212-7211234 CAGGAGAGCGGGAGGGAGGGAGG + Intronic
969659539 4:8518414-8518436 CATTAGGGCAGAAGGGAGGGCGG + Intergenic
970262213 4:14238422-14238444 CATGAGAATTGGAGGGAAAGAGG + Intergenic
970694451 4:18660914-18660936 CTTGAGAACTGGAGGAAGGTGGG + Intergenic
972345774 4:38191125-38191147 CAGGACAACTGGAGGGAGAGAGG - Intergenic
972589051 4:40466761-40466783 CATTAGAAATTGGGGGGGGGGGG + Intronic
973238749 4:47934273-47934295 CATAAGGACAGGAGTGAGGGTGG - Intronic
974021635 4:56696561-56696583 CACTTGAACCCGAGGGAGGGGGG + Intergenic
974543791 4:63274825-63274847 CATTGAGAATGGAGGGAGGGAGG + Intergenic
976336728 4:83896511-83896533 CATTAGAAAAGGAGGGCTGGGGG - Intergenic
978700817 4:111643783-111643805 CATTACAACTGAAAGGAGTGGGG + Intergenic
978811544 4:112854866-112854888 GAGTAGAATGGGAGGGAGGGTGG + Intronic
981031426 4:140129381-140129403 CATAAGAATTGGGGGTAGGGGGG - Intronic
982700532 4:158656288-158656310 AATTAGAACTGGAGGTATGGAGG - Intergenic
983812700 4:172082859-172082881 TATTGGAAGTGGAGGGAGAGGGG + Intronic
984398862 4:179235809-179235831 AATCAGAATTGGAGGGAGTGGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985511582 5:316960-316982 CATCAGAAGTCAAGGGAGGGAGG + Intronic
985827481 5:2203719-2203741 CACTAGAAATGGAGGGAGAGAGG - Intergenic
987325705 5:16810320-16810342 CATGGGGACTGTAGGGAGGGAGG - Intronic
988130765 5:27101871-27101893 CATTATAACTAGAGGTAGAGTGG + Intronic
988878948 5:35479153-35479175 GAATAGAACTGAAAGGAGGGTGG - Intergenic
990007182 5:50957305-50957327 AATTAGGAAGGGAGGGAGGGAGG - Intergenic
990493671 5:56325937-56325959 CACTAGAACTAGAAGGATGGGGG + Intergenic
990991002 5:61684075-61684097 GATTAGGAACGGAGGGAGGGAGG - Intronic
991605113 5:68393413-68393435 TATTACAGCTGGAGGGAGAGGGG + Intergenic
992185418 5:74239604-74239626 CATTAAAACTGGGGTGGGGGGGG + Intergenic
992748048 5:79838115-79838137 CATTAGAACAGGAGTGAAAGAGG - Intergenic
992960228 5:81950609-81950631 CATTTGAACTTGGGAGAGGGAGG + Intergenic
994758737 5:103827275-103827297 CATTAGAAATTGAGGGATGGAGG + Intergenic
995321370 5:110837901-110837923 CCTGAAAACTGGAGGGAAGGGGG - Intergenic
995396932 5:111696924-111696946 CATATGAACTTGGGGGAGGGTGG + Intronic
995404656 5:111781142-111781164 TATCAGAAGTGGAGGGTGGGAGG - Intronic
995531510 5:113096033-113096055 AGCTAGAAGTGGAGGGAGGGTGG - Intronic
996710288 5:126536625-126536647 CATCAGAACCGGAGAGAGGTGGG + Intergenic
998059855 5:139111452-139111474 CATTGGAGCTGGATGGAGAGAGG - Intronic
999079436 5:148828958-148828980 AAGTAGAACTGGAAGGTGGGTGG - Intergenic
999127414 5:149256110-149256132 CTTGAGAACTGGAGGGAGAAAGG + Intronic
999175909 5:149631560-149631582 CATTAGATCTGGAGAGGGAGAGG + Intronic
1000537309 5:162494454-162494476 CACTGTAAATGGAGGGAGGGAGG + Intergenic
1001320947 5:170680977-170680999 CTTTAGAACAGCAGGAAGGGAGG + Intronic
1002916778 6:1535554-1535576 CATTGGAACTGGAGGGTGTTTGG - Intergenic
1003335828 6:5171351-5171373 CATAGGAGCTGGAGGGATGGAGG - Intronic
1003511637 6:6786033-6786055 CAATAAAACTGAAGGGACGGGGG + Intergenic
1003567784 6:7235239-7235261 CATTAGAGCTGGAAGGAGCCTGG + Intronic
1004959301 6:20768615-20768637 CATTACAACTGAATGGAGGAAGG - Intronic
1005160126 6:22850089-22850111 CCTGAGAACTGGAGGGAGTTGGG + Intergenic
1005500724 6:26426817-26426839 CATGACACATGGAGGGAGGGTGG + Intergenic
1005723759 6:28628884-28628906 CCTAAGAGCTGGAGGGTGGGTGG + Intergenic
1005791558 6:29307817-29307839 CACTTGAATTGGAGGGAGGAAGG - Intergenic
1006184908 6:32176030-32176052 CAGCAGAAAGGGAGGGAGGGAGG - Intronic
1006409880 6:33866812-33866834 CATTAGTAATGGGGGTAGGGAGG + Intergenic
1006920132 6:37622362-37622384 CATTTCAACTGGAGGGAAGGAGG - Intergenic
1007518406 6:42431584-42431606 AAGTAGAACTGGAGGAAGGGAGG + Intronic
1007622546 6:43223762-43223784 CATTAGAGCTGGAGAGAGCCTGG - Intronic
1007692318 6:43710555-43710577 GAGAAGAAATGGAGGGAGGGAGG + Intergenic
1007883291 6:45191601-45191623 AATTGAAACTGTAGGGAGGGTGG + Intronic
1008035766 6:46743528-46743550 CTTTAGAATTGGAAGGAGGTAGG + Intergenic
1008288520 6:49683578-49683600 CACTTGAACTGGCGGGATGGAGG + Intergenic
1010462968 6:76134083-76134105 GGTTAGGTCTGGAGGGAGGGAGG + Intergenic
1011148214 6:84242059-84242081 CATTGTAACTGGAGGCAGAGAGG + Intergenic
1013314556 6:108929132-108929154 GATCAGATCTGGAGGGAAGGAGG - Intronic
1013500938 6:110750787-110750809 GGAAAGAACTGGAGGGAGGGAGG + Intronic
1014694913 6:124608407-124608429 CAATATATTTGGAGGGAGGGAGG + Intronic
1014803822 6:125807109-125807131 CATTAGATATGGAGGGAGAGAGG - Intronic
1015609758 6:135003894-135003916 AATTAAAAATGGAGGGATGGAGG + Intronic
1015805273 6:137102210-137102232 CATTAGATGGGGAGGGAAGGAGG - Intergenic
1019686824 7:2386583-2386605 CATCAGGAAGGGAGGGAGGGAGG + Intergenic
1021760130 7:23895599-23895621 ACTTAGGACTGGAGTGAGGGAGG + Intergenic
1022002909 7:26243001-26243023 TATTAGACCTAGAGAGAGGGAGG - Intergenic
1022139080 7:27476497-27476519 CATTCAAAAGGGAGGGAGGGAGG + Intergenic
1022430363 7:30313512-30313534 CAGTAGAAAGGCAGGGAGGGAGG - Intronic
1022443417 7:30451717-30451739 CACTGGAACGGGAGGAAGGGAGG + Exonic
1022466500 7:30656005-30656027 AAATTGATCTGGAGGGAGGGCGG + Exonic
1024007187 7:45233625-45233647 CATCAGGAATTGAGGGAGGGAGG - Intergenic
1024939268 7:54745326-54745348 CAATAGAACTAGAAGGAGGTAGG - Intergenic
1025603962 7:63025430-63025452 TATTAGAAATGGTGGGAGGGAGG + Intergenic
1026079554 7:67205535-67205557 CATTACAGCTGGAGGGGAGGAGG + Intronic
1026686270 7:72512895-72512917 CACTTGAACTCGAGAGAGGGAGG - Intergenic
1026697295 7:72606447-72606469 CATTACAGCTGGAGGGGAGGAGG - Intronic
1027837741 7:83266787-83266809 CAGGAGAAGAGGAGGGAGGGAGG + Intergenic
1028600089 7:92591584-92591606 CATGAAAAATGCAGGGAGGGAGG - Intergenic
1029207354 7:98877936-98877958 CATCAAAACTGGATGGAGAGAGG - Intronic
1029303516 7:99602202-99602224 GATTGGAGCTGCAGGGAGGGTGG - Intronic
1031547610 7:123069011-123069033 CATTGAAAGTGGATGGAGGGAGG - Intergenic
1032143309 7:129354248-129354270 CATTAAAACAGGAGGGAGATAGG + Intronic
1032577455 7:133070640-133070662 GCTTTGAACAGGAGGGAGGGAGG - Intronic
1032989821 7:137381304-137381326 AATACGAAGTGGAGGGAGGGTGG - Intronic
1033075277 7:138244123-138244145 CATTAGAATGGGAAGGAGGAAGG - Intergenic
1033258077 7:139819010-139819032 CACTAGAACAGGCTGGAGGGTGG - Intronic
1035305010 7:157926550-157926572 AATGAGAAGTGGAGGCAGGGAGG + Intronic
1036781225 8:11649226-11649248 TATTACAAATGGTGGGAGGGAGG - Intergenic
1037709219 8:21342338-21342360 CATTAACACTGGAGGGATGGAGG + Intergenic
1038349449 8:26762892-26762914 CATCAGGACTGGAGAGAGGAAGG + Intronic
1038426162 8:27465261-27465283 AATTAGAAGGGGAGGGAGGATGG - Intronic
1041419282 8:57648359-57648381 CTCTAGAAATGGAGGGTGGGTGG - Intergenic
1041804238 8:61832677-61832699 GATTGGCACTGGAGGAAGGGAGG + Intergenic
1043651001 8:82591954-82591976 CACTTGAACCGGAGAGAGGGAGG + Intergenic
1045487103 8:102640346-102640368 AAGGAGAAATGGAGGGAGGGAGG + Intergenic
1047004775 8:120609286-120609308 CATTAACACAGGAGGGAAGGGGG - Intronic
1047200370 8:122760217-122760239 CCTTAGAACTGGAGGGAGGGAGG + Intergenic
1047595457 8:126373411-126373433 AAATAGAACAGGAGGAAGGGAGG - Intergenic
1049069733 8:140347142-140347164 CATTAGAGCGGGAGGCTGGGAGG + Intronic
1055224453 9:73977447-73977469 CAGAAGAACGGGAGGAAGGGAGG + Intergenic
1055672381 9:78620391-78620413 AATTGGAGCTGCAGGGAGGGGGG - Intergenic
1055881224 9:81006289-81006311 CATTATAAGGGTAGGGAGGGAGG + Intergenic
1056507978 9:87275406-87275428 CACTAGAGCAGGAGGGAGGCAGG + Intergenic
1058049475 9:100392292-100392314 CACCAGAACTCGAGGCAGGGAGG - Intergenic
1058710906 9:107678269-107678291 CACTTGAACTTGAGGGAGGATGG + Intergenic
1059329669 9:113526878-113526900 CATTAGAACTGGGGGCTAGGAGG - Intronic
1060346301 9:122819418-122819440 CATTAGAGCTGGAGTGGGGCTGG - Exonic
1061057716 9:128233173-128233195 CATAAGAACTGGGGGGAAAGAGG + Intronic
1062181440 9:135193243-135193265 CAGGAGCACTGAAGGGAGGGAGG - Intergenic
1062362934 9:136196053-136196075 CATGAGCACTGGAAGGAGGTGGG - Intergenic
1062461484 9:136664305-136664327 CATGGGAGCTGGAGGAAGGGAGG - Intronic
1187106437 X:16247731-16247753 CATTAAAACTGTAGGGTGGGTGG + Intergenic
1189202272 X:39206818-39206840 GATTAGACATGGAGGGAGAGAGG + Intergenic
1190006920 X:46749154-46749176 CATAAGAACTTGAAGGAGGAGGG + Intronic
1190055939 X:47181169-47181191 CATTAGAACAGGAAGGTGTGGGG - Intronic
1193273387 X:79555137-79555159 CATGAAAACAGGAGGGAGGAGGG + Intergenic
1193375014 X:80749324-80749346 AATAAAAACTGAAGGGAGGGAGG - Intronic
1195480978 X:105344579-105344601 CATTAGAATTTCAGAGAGGGTGG - Intronic
1195880337 X:109586532-109586554 AATGAGAACAGGAGGGAGGTGGG - Intergenic
1197899307 X:131352749-131352771 CATTACGACTGGAGAGAGGTAGG + Intronic
1197923926 X:131626753-131626775 CATTAGAAAGGGAGGCAGGGAGG + Intergenic
1198008986 X:132531238-132531260 GATTGGTACAGGAGGGAGGGTGG + Intergenic
1198536168 X:137589104-137589126 AATTAGAACTTGAAGGAAGGGGG - Intergenic
1199668226 X:150119042-150119064 CATAACAACTGGAGGGAAGCTGG + Intergenic
1200762549 Y:7053534-7053556 GATAAGAACTGGAGGTTGGGTGG + Intronic