ID: 902990693

View in Genome Browser
Species Human (GRCh38)
Location 1:20185560-20185582
Sequence CAGTGTGGCCCCGGAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902990693 Original CRISPR CAGTGTGGCCCCGGAGTGGG AGG Intergenic
900098895 1:952653-952675 CACAGGGGCCCTGGAGTGGGCGG - Intronic
900125804 1:1068536-1068558 GAGTGTGACCCCAGGGTGGGAGG - Intergenic
900140457 1:1137402-1137424 CTCTGTGGCCCTGGGGTGGGAGG + Intergenic
900299593 1:1970069-1970091 CAGTGGGGCCCGTGGGTGGGGGG + Intronic
900403270 1:2481521-2481543 CAGAGTGGCCTCTGAGTGGGAGG + Intronic
900991891 1:6101951-6101973 CAGGGTGGCCCCGGCGGGGGCGG - Exonic
901212467 1:7534364-7534386 CCGTGTGGCCCCGGGGTGTCAGG - Intronic
902057269 1:13611750-13611772 CAGTGTTGGCGGGGAGTGGGGGG + Intronic
902075206 1:13779137-13779159 CAGTCTGGCCCAAGACTGGGAGG - Exonic
902510870 1:16966302-16966324 CAGTCTGGCCCTGCACTGGGTGG + Intronic
902859359 1:19233797-19233819 CAGTGTTACCCCGCAGTGAGTGG - Intronic
902988218 1:20168734-20168756 CAGGGAGGACCCGGTGTGGGAGG - Intronic
902990693 1:20185560-20185582 CAGTGTGGCCCCGGAGTGGGAGG + Intergenic
904559821 1:31388858-31388880 CAGGCTGGCTGCGGAGTGGGTGG - Intergenic
905883984 1:41481976-41481998 CAGGGTGGCCCCAGAGTTGCTGG - Intronic
910363432 1:86438158-86438180 CAGTGTCATCCCTGAGTGGGTGG + Intronic
914834905 1:151198857-151198879 GAGGGAGGCCCCGGAGGGGGCGG + Exonic
916166544 1:161971229-161971251 CAGTGTGCCCTGGGAGTGGGCGG + Intergenic
921671356 1:217927310-217927332 CAGTGTGTCCTGGGAGTGGTAGG + Intergenic
923051106 1:230392201-230392223 CAGGGCAGCCCCGGTGTGGGGGG - Intronic
1063116603 10:3076231-3076253 CAGTGTGGTCACGCAATGGGTGG + Intronic
1067023876 10:42826921-42826943 CAGCGTGGCCCCGCAGGGTGGGG + Intronic
1067148511 10:43710837-43710859 CAGTGTGGACCAGGGGTAGGTGG + Intergenic
1067460275 10:46453046-46453068 CTGTGTGTCCCCAGAGTGTGGGG + Intergenic
1067626915 10:47931557-47931579 CTGTGTGTCCCCAGAGTGTGGGG - Intergenic
1067796858 10:49327149-49327171 CAGGGTGGGCCAGGAGAGGGAGG - Exonic
1067849048 10:49743553-49743575 TAGTCTCACCCCGGAGTGGGGGG + Intronic
1069824013 10:71244314-71244336 CTGAGTGGCCCTGGGGTGGGGGG - Intronic
1070441668 10:76452109-76452131 CAGTGTGGACAGGAAGTGGGTGG + Intronic
1070756366 10:78995897-78995919 CATAGTGGCCAAGGAGTGGGAGG - Intergenic
1075002441 10:118808611-118808633 CAGAGTGGCCCAGGACTGAGGGG - Intergenic
1075645568 10:124093737-124093759 CAGTGTTGACTCGGAGGGGGAGG - Intergenic
1076408119 10:130226825-130226847 CAGTGTGTGGCAGGAGTGGGTGG + Intergenic
1076514156 10:131033789-131033811 CAGGGTGTCCCTGCAGTGGGTGG + Intergenic
1076649785 10:131979988-131980010 CACTGTGGGCTCGGCGTGGGCGG - Intronic
1077579091 11:3405258-3405280 CACTGTTGCCCAGGTGTGGGAGG + Intergenic
1077702495 11:4455130-4455152 GAGTGTGACCCCTAAGTGGGGGG - Intergenic
1081755420 11:45540895-45540917 GAGTTTGGCCCAGAAGTGGGGGG - Intergenic
1083658705 11:64242216-64242238 AAGTGTGGCCCCGGAGCCCGGGG + Intronic
1084236112 11:67788776-67788798 CACTGTTGCCCAGGTGTGGGAGG + Intergenic
1084836290 11:71804213-71804235 CACTGTTGCCCAGGTGTGGGAGG - Intergenic
1085268145 11:75249940-75249962 CAGTGTGGGACCAGAGAGGGGGG - Intergenic
1085470503 11:76754326-76754348 CAATGTGGCCCAAGAGAGGGAGG - Intergenic
1091205994 11:133821567-133821589 CAATGTGACCACGGAGGGGGTGG + Intergenic
1092407021 12:8228141-8228163 CACTGTTGCCCAGGTGTGGGAGG + Intergenic
1092900434 12:13054725-13054747 CAGTGAGGCCAAGGGGTGGGTGG + Intronic
1095596135 12:43960276-43960298 CAGGGAGGCCCTGGAGAGGGGGG + Intronic
1096075224 12:48799983-48800005 CAGTGTGGGGGCGGGGTGGGGGG - Intergenic
1096263920 12:50109370-50109392 TAGAGTGGACCAGGAGTGGGAGG + Intronic
1101823118 12:108199321-108199343 CATCATGGCCCGGGAGTGGGAGG + Intronic
1102539703 12:113609985-113610007 CAGTTTGGCCTCGGGCTGGGCGG + Intergenic
1106185365 13:27404991-27405013 CAGGTTGGCGCCGGGGTGGGAGG + Intergenic
1107869326 13:44732658-44732680 CAGGGTGGGGCCGGAGTGAGAGG - Intergenic
1108323216 13:49306167-49306189 CACTGTGGGCCCAGTGTGGGGGG + Intergenic
1109560016 13:64034454-64034476 CTGTGTGCCCCTGTAGTGGGAGG + Intergenic
1111097423 13:83534097-83534119 CAGGGTGGACCCGGAGAGGGAGG - Intergenic
1112326141 13:98443894-98443916 CAGTGAGGCCAGGGAGTGGCGGG + Intronic
1113778984 13:112965262-112965284 CACACTGGCCCCGGAGGGGGAGG + Intronic
1119080904 14:71692677-71692699 CAGAGTGGCCCAGGAATGGGAGG + Intronic
1119181044 14:72605498-72605520 CAGTGTGTCCCCAAGGTGGGTGG - Intergenic
1121588209 14:95078627-95078649 CAGTGTGGCAGCGGGGTGGGGGG - Intergenic
1121760035 14:96436889-96436911 CAGTGTGGCCTGGGACTGGTTGG + Intronic
1122238987 14:100349470-100349492 CTGTGTGGCCCGGGCATGGGAGG - Intronic
1122392188 14:101397407-101397429 CACTCTGGCCACGCAGTGGGCGG + Intergenic
1123061479 14:105596668-105596690 GTGTGTGGCCCTGGAGTGGCTGG - Intergenic
1123085932 14:105717579-105717601 GTGTGTGGCCCTGGAGTGGCTGG - Intergenic
1123124378 14:105935658-105935680 CAGTGAGGTCGCAGAGTGGGAGG + Intergenic
1124577616 15:30923654-30923676 CAGCCTGGCCTCGGAGAGGGAGG - Intronic
1124904741 15:33857943-33857965 CGGGGTGGCCCCGCAGTGGGTGG - Intronic
1125516711 15:40324650-40324672 CCGGCTGGCCCCGGAGCGGGAGG + Intergenic
1128242416 15:66110011-66110033 CAGAGGGGCCCCGGGGTGGCAGG + Intronic
1129523741 15:76201313-76201335 CAGAGTGGCCTGAGAGTGGGAGG - Intronic
1129851528 15:78796561-78796583 CTGTGTGGGCCAGGAGCGGGTGG - Intronic
1131270977 15:90947527-90947549 CAGTGTGGCCTGGGAAGGGGTGG + Intronic
1131810873 15:96171459-96171481 CAGTGTGGGGCTGGGGTGGGTGG - Intergenic
1132100535 15:99020039-99020061 CAGTGTGGCCATGGGGTTGGTGG + Intergenic
1132466458 16:79578-79600 CGGTATGGGCCCGGAGTGGTGGG - Exonic
1132467960 16:86313-86335 CAGGGTGGCCACAGACTGGGGGG + Exonic
1132555993 16:572902-572924 GAGTGTGGCTCCAGCGTGGGGGG + Intronic
1133347693 16:5081338-5081360 CACTGTTGCCCAGGTGTGGGAGG + Intronic
1136346540 16:29679503-29679525 CAGTGGGGGCCGGAAGTGGGAGG + Intronic
1137724546 16:50648138-50648160 CAGTGGGGCCCAGGAGTGAGTGG - Intergenic
1139446172 16:67000171-67000193 GAGTGTGGCCGAGGAGTAGGAGG + Intronic
1139926464 16:70490440-70490462 CAGTCTGGCATTGGAGTGGGTGG - Intronic
1140985445 16:80154109-80154131 CAATGTGGCCCTGGAGTGATAGG - Intergenic
1141314146 16:82944536-82944558 CAGTGTGGACCAGGAGTGGGAGG + Intronic
1141675129 16:85513777-85513799 CAGTGTGCACCGGGGGTGGGGGG - Intergenic
1142010175 16:87709897-87709919 CAGTGAGGACACGCAGTGGGGGG - Intronic
1142411742 16:89920517-89920539 CGGAGTGTCCCAGGAGTGGGCGG - Exonic
1145248370 17:21284412-21284434 CAGTGGGTCCCGGGAGTGGGTGG + Intergenic
1146185384 17:30720994-30721016 CAGTGTGGGCCCGGGGGTGGGGG + Intergenic
1148444236 17:47727863-47727885 CAGTCTGGGCCCAGAGGGGGAGG + Intergenic
1148969279 17:51465134-51465156 CAGTGTGGTCCAGCAGTGGTGGG + Intergenic
1149681281 17:58508966-58508988 CAGTGGGGACCCAGGGTGGGGGG + Intronic
1151908607 17:77066429-77066451 CAGTGGGTCCCTGGGGTGGGTGG - Intergenic
1152643519 17:81458733-81458755 CAGTGGGCTCCCAGAGTGGGGGG - Intronic
1152654598 17:81513915-81513937 CAGTGAGGCCGCGCAGTGAGGGG + Intronic
1152687772 17:81703070-81703092 CACTGGGGGCCCGGAGCGGGCGG + Intronic
1152742454 17:82024266-82024288 CAGTGTGGCCCCTGTGTAAGGGG - Exonic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1157324040 18:46656568-46656590 CAGTCTGGTCCCCGAGTAGGTGG - Intronic
1158677066 18:59529618-59529640 CTGTGTGGCTCCTGAGTGGGTGG + Intronic
1159999595 18:75004106-75004128 CAGTGTGGCCCTGGAGTGCCTGG + Intronic
1160509304 18:79444424-79444446 CAGCGTGGGCTCGGGGTGGGTGG - Intronic
1160596905 18:79982105-79982127 CAGTGTGGTCACGGGGTGGCAGG + Intronic
1160760355 19:781084-781106 CTGTGGGGCCCCGGAGGGGCGGG + Intergenic
1160785951 19:900396-900418 TTGTGTGGGCCTGGAGTGGGTGG - Intronic
1161888819 19:7019095-7019117 GGGTGTGGCCCCGCAGTTGGGGG - Intergenic
1162026124 19:7895087-7895109 CAGAGTGCCCCTGGAGGGGGTGG + Intronic
1162940459 19:14006075-14006097 CAGGGCGGCCCCGGGGTGGCTGG - Intronic
1162973388 19:14194702-14194724 CAGTGTGGGCCCGGGGGTGGGGG - Intronic
1164643638 19:29843523-29843545 CAGGGTGGCCCCGGAGGAGGGGG + Intergenic
1164792837 19:31002696-31002718 CCGTGTGGCCCCGGAGAGTCAGG + Intergenic
1165594430 19:37000219-37000241 CAGCTTGAACCCGGAGTGGGAGG + Intergenic
1165914203 19:39247903-39247925 CGGTGAGGCCCGGGAGTGGGCGG - Intergenic
1166217374 19:41344423-41344445 CAGTGATGACCCAGAGTGGGTGG - Intronic
1166230860 19:41425315-41425337 CTGTGGGGCCCTGGAGTGGTGGG - Intronic
1166352048 19:42203884-42203906 CAGTGTGGCCCTGAGGTGGCAGG + Intronic
1166656833 19:44618419-44618441 GAGTGGGGCCCCGCAGTGGGAGG + Intronic
1166745396 19:45139681-45139703 CAGTGTGGCAGCTGAGAGGGTGG + Intronic
1167162864 19:47779075-47779097 CAGCGGAGCCCCGGAGTCGGGGG - Intronic
1167244566 19:48365456-48365478 CTGTGGGCCCCAGGAGTGGGGGG - Intronic
1167597970 19:50437232-50437254 CATGGTGGCCCAGGTGTGGGGGG + Intronic
1168340836 19:55622185-55622207 CGGGGTGGCCCCGGAGAGGGCGG - Exonic
925217399 2:2109265-2109287 CAGTGTGTCCCAGGAGTAGCAGG + Intronic
933190060 2:79324401-79324423 CATAGTGGCCCTGGAGTGGGAGG + Intronic
934754609 2:96816508-96816530 CTGGGTGGCCCCGGAGGGGGCGG + Exonic
935170783 2:100610281-100610303 CAGTGAGGTCCCGGGGTCGGTGG + Intergenic
936745948 2:115576765-115576787 AAGTGTGGGCCTGGAGTTGGAGG - Intronic
942339745 2:174931396-174931418 GAGTTTGGCACAGGAGTGGGAGG - Intronic
946431570 2:219629390-219629412 CTGTGGGGTCCCTGAGTGGGGGG - Exonic
948355614 2:237374755-237374777 CAGGGCGGCCCCGGTGTTGGGGG + Exonic
1169334940 20:4748431-4748453 CAGTGGGTCCCCAGGGTGGGTGG - Intergenic
1172037192 20:32018775-32018797 AAGTGTGGAAGCGGAGTGGGCGG + Intronic
1172920032 20:38473240-38473262 AAGCTTGGCCCTGGAGTGGGCGG + Intronic
1173572471 20:44086286-44086308 CATTGTGGCCTCGGTGTGGCAGG + Intergenic
1174395694 20:50245646-50245668 CAGTGTGGCCAGGCTGTGGGAGG + Intergenic
1174485955 20:50861395-50861417 CAGTGTGGGCCTGGGGTGGAGGG + Intronic
1174614745 20:51827220-51827242 CACTGTGGCCCCGCAATGGATGG + Intergenic
1174614766 20:51827335-51827357 CACTGTGGCCCCGCAGTGGACGG + Intergenic
1175859438 20:62142714-62142736 AAGTGTTGCCCCGGAGCGGGTGG + Intronic
1175889873 20:62311336-62311358 AAGGGTGGCCCCTGTGTGGGCGG - Intronic
1175895144 20:62332777-62332799 CAGGGAGGCGCTGGAGTGGGAGG - Intronic
1178403030 21:32303526-32303548 CAGTGTGGACCCAGAGGGGAAGG + Intronic
1179611944 21:42557645-42557667 CAGTGTGGGCACCCAGTGGGTGG - Intronic
1179722250 21:43322452-43322474 CAGTGTGGAGCCGCAGTGGTGGG - Intergenic
1179957905 21:44751430-44751452 CACTGTGACCCCGGAGCTGGTGG - Intergenic
1180159497 21:45992745-45992767 CAGGGTGGCCCTGGAGAGAGAGG + Exonic
1180772826 22:18402125-18402147 CAGCGAGGCCCCGGGATGGGAGG - Intergenic
1180806569 22:18717736-18717758 CAGCGAGGCCCCGGGATGGGAGG + Intergenic
1181217515 22:21343518-21343540 CAGCGAGGCCCCGGGATGGGAGG + Intergenic
1183352608 22:37342558-37342580 CAGTGGGACCCAGGAGTGGGGGG - Intergenic
1183734909 22:39639002-39639024 CTGTGTGGCCCCGGGGTTTGGGG + Intronic
1185278108 22:49958511-49958533 CAGCCTGGCCCTGGAGTGGAGGG - Intergenic
1203234661 22_KI270731v1_random:143113-143135 CAGCGAGGCCCCGGGATGGGAGG - Intergenic
950433988 3:12967714-12967736 GAATGTGGCCCTGAAGTGGGCGG + Intronic
950661684 3:14470703-14470725 CAGTGGGGCCCCGGTCTGGGTGG + Intronic
953058480 3:39406944-39406966 CAGAGTGCCCCGGGAGCGGGTGG + Intronic
953670636 3:44959140-44959162 CAGCATGGCCCGGCAGTGGGAGG + Exonic
954129723 3:48554228-48554250 CAGTCTGGACCCGGAGGGTGTGG - Intronic
954219159 3:49142228-49142250 CAGTCTTGCCCCAGAGTGCGGGG + Intergenic
957052079 3:75418576-75418598 CACTGTTGCCCAGGTGTGGGAGG + Intergenic
961649317 3:128409627-128409649 GAGTGTGGCCCCGGTGAGCGTGG + Intergenic
961743274 3:129046959-129046981 CGGAGGGGCCCCGGAGCGGGAGG - Intergenic
961885688 3:130094808-130094830 CACTGTTGCCCAGGTGTGGGAGG + Intronic
962280227 3:134046461-134046483 CATTGTGGCACTGGAGTGGTTGG - Intronic
962318006 3:134370833-134370855 CAGGGGGGCCCCTCAGTGGGGGG + Exonic
962941194 3:140126105-140126127 GAGTGGGGCCACGAAGTGGGAGG + Intronic
968460543 4:722730-722752 GAGTGTGGACCCGGCGTGGGTGG - Intronic
968460550 4:722762-722784 GAGTGTGGACCCGGCGTGGATGG - Intronic
968460556 4:722794-722816 GAGTGTGGACCCGGCGTGGATGG - Intronic
968460562 4:722826-722848 GAGTGTGGACCCGGCGTGGATGG - Intronic
968460568 4:722858-722880 GAGTGTGGACCCGGCGTGGATGG - Intronic
968460574 4:722890-722912 GAGTGTGGACCCGGCGTGGATGG - Intronic
968460580 4:722922-722944 GAGTGTGGACCCGGCGTGGATGG - Intronic
968460587 4:722955-722977 GAGTGTGGACCCGGCGCGGGCGG - Intronic
968460601 4:723019-723041 GAGTGTGGACCCGGCGTGGATGG - Intronic
968460607 4:723051-723073 GAGTGTGGACCCGGCGTGGATGG - Intronic
968460614 4:723084-723106 GAGTGTGGACCCGGCGCGGGTGG - Intronic
969759122 4:9169843-9169865 CACTGTTGCCCAGGTGTGGGAGG - Intergenic
969819085 4:9707323-9707345 CACTGTTGCCCAGGTGTGGGAGG - Intergenic
970906599 4:21223900-21223922 CAATGTGGGCAAGGAGTGGGCGG - Intronic
972437072 4:39044855-39044877 CCGGGTGGCCCCGGAGGGGGCGG - Intergenic
972583507 4:40416029-40416051 CACTGTGGCCCCAGTGTGGAAGG + Intergenic
973926543 4:55744225-55744247 CAGGGTGGCCCAGTAGTGGTGGG + Intergenic
975166905 4:71187350-71187372 CAGTTTGGCGGCGGAGTGTGGGG - Exonic
977801765 4:101242842-101242864 CACTGTAGCCCAGGAGTTGGAGG + Intronic
982227060 4:153175958-153175980 CAGTGGGGCCCAGGAGTTTGAGG + Intronic
983871402 4:172828410-172828432 GACTGTGGCCCCTGAGTGAGGGG - Intronic
985631753 5:1017667-1017689 CAGGGCGGCCCCGTGGTGGGGGG - Intronic
985675773 5:1230571-1230593 CAGGGAGGCCCTAGAGTGGGAGG - Intronic
986321102 5:6633323-6633345 TACTGCGGCCCCGGCGTGGGTGG + Exonic
990446855 5:55901328-55901350 CAGTGTGGCCCCAGGATGGGAGG + Intronic
996150035 5:120023633-120023655 CAGTGGGGACCCTGTGTGGGGGG - Intergenic
996324693 5:122259165-122259187 CAGTGTGTCCCAAGAGTGAGGGG + Intergenic
998179214 5:139924787-139924809 CAGCGAGGCCCCGGAAAGGGAGG - Intronic
998416590 5:141950624-141950646 CAGTGTGACCCTGGAGTGTGTGG + Intronic
999196369 5:149784290-149784312 GAGCGTGGCCTCTGAGTGGGAGG - Intronic
999288519 5:150408332-150408354 GAGGATGGCCCCAGAGTGGGTGG - Intronic
1001402169 5:171451882-171451904 CTGTGGGGCTCCGGGGTGGGTGG - Intronic
1002069315 5:176669993-176670015 CAGAGTGGCCCCATGGTGGGTGG + Intergenic
1002334897 5:178470801-178470823 CAGTGGGGCCCTGGAGGCGGTGG - Intronic
1002416345 5:179122805-179122827 CAGTGCGGGCCCTGTGTGGGAGG - Intronic
1002475406 5:179462256-179462278 CAGTGTGGTCCAGGGGTGTGAGG - Intergenic
1007138801 6:39550386-39550408 AGGTGTGCCCCAGGAGTGGGAGG + Intronic
1007495771 6:42259562-42259584 CAGGGTGGCGCCCGAGTAGGAGG + Exonic
1008492556 6:52101470-52101492 CAGTCTTGGCCAGGAGTGGGTGG - Intergenic
1012989629 6:105911877-105911899 CAGGGAAGCCCTGGAGTGGGAGG - Intergenic
1016289077 6:142507459-142507481 CCGTGTTGCTCCTGAGTGGGTGG + Intergenic
1017617902 6:156264704-156264726 CAGTGTAGCTTTGGAGTGGGAGG + Intergenic
1019135216 6:169903633-169903655 CAGTGTGGCCATGGAGTGAGGGG + Intergenic
1019354857 7:573134-573156 CAGTGTGACCCCGGGGTGCAGGG - Intronic
1019368337 7:646977-646999 CAGCCTGGGCCAGGAGTGGGGGG - Intronic
1019415305 7:924249-924271 CAGTGTGGACCTGGAGGGCGGGG - Intronic
1019450005 7:1092631-1092653 CAATGTGGCCCGTGAGGGGGTGG - Exonic
1019897871 7:3997315-3997337 CAGAGGAGCCCCGCAGTGGGTGG + Intronic
1020319142 7:6927273-6927295 CACTGTTGCCCAGGTGTGGGAGG + Intergenic
1023937258 7:44748846-44748868 CATTGTGCCCTCGGAGCGGGCGG + Intronic
1024260924 7:47573333-47573355 CAGGGTGTCCCCAGGGTGGGAGG - Intronic
1025829507 7:65037780-65037802 CAGAGTGTCCCCGGAGGTGGTGG + Intergenic
1026955135 7:74372269-74372291 CAATGGGGCCCGGGAGTGGGAGG + Intronic
1027355062 7:77346774-77346796 CATTGTGAACCAGGAGTGGGTGG - Intronic
1032383188 7:131504583-131504605 CAGTGGGGCTCCTGAGTGGGAGG - Intronic
1032471048 7:132179690-132179712 CCGTGTGGCCCTGGAGTGCAAGG - Exonic
1034652952 7:152706586-152706608 AGGTGTGGCCCCTGAGGGGGTGG + Intergenic
1034834525 7:154339350-154339372 CAGTGGGAACGCGGAGTGGGAGG + Intronic
1036381268 8:8237874-8237896 CACTGTTGCCCAGGTGTGGGAGG - Intergenic
1036760699 8:11506811-11506833 CTGGGGGGCCCCAGAGTGGGAGG - Intronic
1036847392 8:12179118-12179140 CACTGTTGCCCAGGTGTGGGAGG + Intergenic
1037822556 8:22141946-22141968 CAGTGTAGCCCCGGAGGGGGCGG + Exonic
1038754874 8:30331115-30331137 GAGTGCTGCCCAGGAGTGGGTGG + Intergenic
1046075424 8:109306634-109306656 CAGTGGGGTCCGGGGGTGGGGGG - Intronic
1047168524 8:122466851-122466873 CAGTGTGGGGAGGGAGTGGGTGG - Intergenic
1047533590 8:125699007-125699029 CAGAGTAGCCCCGGAGGGAGTGG - Intergenic
1048305783 8:133283789-133283811 CAGTGCGGCCCCAGAGTATGTGG + Intronic
1048333999 8:133489801-133489823 AAGAGGGGCCCAGGAGTGGGCGG - Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049143678 8:140981356-140981378 CAGAGTGGCACCGGTGTGAGGGG + Intronic
1049235842 8:141511880-141511902 CCGTGTGGCCCCGGAGGCAGAGG + Intergenic
1049726282 8:144148010-144148032 CAGCAGGGGCCCGGAGTGGGCGG - Intronic
1049755248 8:144308665-144308687 CTGTGAGGCCCAGGACTGGGCGG - Intronic
1049789993 8:144468135-144468157 CAGAGGGGCCACGGAGAGGGGGG - Intronic
1050377151 9:4985172-4985194 CGGTGTGGCCCCGGAGAGGGTGG + Intronic
1052976048 9:34411040-34411062 CAGTGTGCCCTGGGAGTGGCTGG + Intronic
1052995712 9:34550785-34550807 CAGTGTGGAGCTGGAGAGGGTGG - Intergenic
1056551979 9:87659840-87659862 CACTGTGCCCCCGGTGTGTGCGG - Intronic
1057867689 9:98694130-98694152 CACTGCAGCCCAGGAGTGGGCGG - Intronic
1059682844 9:116603403-116603425 CAGTGTGGCCCAGGAGTGGGTGG + Intronic
1060200694 9:121650434-121650456 AGGTGGGGCCCTGGAGTGGGCGG - Intronic
1061712629 9:132498553-132498575 CAGGGTGGCACAGGAGTGGGTGG - Intronic
1061817935 9:133207466-133207488 CAGTGTGGACCCGGACACGGAGG + Intronic
1062218848 9:135403629-135403651 GAGTGGGGCCCCCGAGTTGGGGG - Intergenic
1062297055 9:135836513-135836535 CTGTGTGGCTGCGGAATGGGTGG - Intronic
1185847108 X:3447864-3447886 CAGTGTGGCCTCGTAGGGGAAGG + Intergenic
1186542233 X:10412236-10412258 CAGTGTGTTCCCCGAGTTGGTGG + Intergenic
1189900471 X:45701118-45701140 CAGTTTGGCACCGTATTGGGTGG - Intergenic
1192947435 X:75981661-75981683 CAGTGGGGCAGGGGAGTGGGAGG - Intergenic
1200060051 X:153480152-153480174 CAGTGTGTCCCAAGGGTGGGGGG - Intronic
1200214689 X:154362536-154362558 AAGTGTGCCCCTGGAGTGGTAGG - Exonic
1200235991 X:154467976-154467998 CCGTGTGGCCCTGGAGTGCAAGG + Exonic