ID: 902990827

View in Genome Browser
Species Human (GRCh38)
Location 1:20186074-20186096
Sequence CGGCGTTGCCCGGGAGACCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 66}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902990813_902990827 12 Left 902990813 1:20186039-20186061 CCGGTCACGCCGGAAGCACGTGG 0: 1
1: 0
2: 0
3: 4
4: 26
Right 902990827 1:20186074-20186096 CGGCGTTGCCCGGGAGACCAGGG 0: 1
1: 1
2: 0
3: 5
4: 66
902990812_902990827 18 Left 902990812 1:20186033-20186055 CCGGTTCCGGTCACGCCGGAAGC 0: 1
1: 0
2: 1
3: 5
4: 47
Right 902990827 1:20186074-20186096 CGGCGTTGCCCGGGAGACCAGGG 0: 1
1: 1
2: 0
3: 5
4: 66
902990809_902990827 24 Left 902990809 1:20186027-20186049 CCCAGGCCGGTTCCGGTCACGCC 0: 1
1: 0
2: 1
3: 0
4: 48
Right 902990827 1:20186074-20186096 CGGCGTTGCCCGGGAGACCAGGG 0: 1
1: 1
2: 0
3: 5
4: 66
902990810_902990827 23 Left 902990810 1:20186028-20186050 CCAGGCCGGTTCCGGTCACGCCG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 902990827 1:20186074-20186096 CGGCGTTGCCCGGGAGACCAGGG 0: 1
1: 1
2: 0
3: 5
4: 66
902990815_902990827 3 Left 902990815 1:20186048-20186070 CCGGAAGCACGTGGCCCCCCACC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 902990827 1:20186074-20186096 CGGCGTTGCCCGGGAGACCAGGG 0: 1
1: 1
2: 0
3: 5
4: 66
902990807_902990827 29 Left 902990807 1:20186022-20186044 CCCGACCCAGGCCGGTTCCGGTC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 902990827 1:20186074-20186096 CGGCGTTGCCCGGGAGACCAGGG 0: 1
1: 1
2: 0
3: 5
4: 66
902990808_902990827 28 Left 902990808 1:20186023-20186045 CCGACCCAGGCCGGTTCCGGTCA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 902990827 1:20186074-20186096 CGGCGTTGCCCGGGAGACCAGGG 0: 1
1: 1
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902990827 Original CRISPR CGGCGTTGCCCGGGAGACCA GGG Exonic
901400754 1:9013815-9013837 CGGCGCTGCCCTGGAATCCAGGG + Intronic
902990827 1:20186074-20186096 CGGCGTTGCCCGGGAGACCAGGG + Exonic
903164246 1:21509627-21509649 CGGCGTGGCGCTGGAGACCCCGG - Intronic
918066535 1:181105420-181105442 CGCCGTTGCCAGGGTGACCGGGG + Intergenic
1063819575 10:9819314-9819336 CGGAATTGGCCAGGAGACCAAGG - Intergenic
1064060008 10:12129551-12129573 CTGCGTTGCCATGGTGACCACGG - Intergenic
1066653406 10:37679988-37680010 GGGGTTTGCCCAGGAGACCAGGG - Intergenic
1067037774 10:42932527-42932549 GGGGTTTGCCCAGGAGACCAGGG - Intergenic
1077368902 11:2172498-2172520 CAGGGTTGCCAGGGCGACCAGGG + Intergenic
1078836519 11:15035369-15035391 CGGCTTTGCCCAGGAGGGCAGGG + Intronic
1083747776 11:64745013-64745035 CCGCGCCGCCCGGGAGGCCAGGG + Intronic
1084418608 11:69049130-69049152 GGGACTGGCCCGGGAGACCAGGG + Intronic
1084973039 11:72781718-72781740 CGCAGCTGCCCGGGAGACCCGGG + Intronic
1086407042 11:86507400-86507422 CTGCCTTGCCTGGGAGGCCATGG - Intronic
1090247127 11:125224472-125224494 CGGCCTTGCCTGGGAGGCCGAGG + Intronic
1090736997 11:129618749-129618771 TGGCGTTGCCGGGGACGCCAGGG - Intergenic
1092204675 12:6607528-6607550 GGGGGTTGCCCGGGAGACCTGGG - Intergenic
1094839826 12:34338233-34338255 GGGCGGTGTCCGGGGGACCAGGG - Intergenic
1096113777 12:49043372-49043394 CGGCTTTGCCCTCGAGGCCACGG + Exonic
1104069373 12:125331098-125331120 CGGTGTTGCCCGCGAGGCCCGGG + Intronic
1113695502 13:112342986-112343008 CAGCGATGCCCGAGAGCCCAAGG + Intergenic
1116003219 14:39266718-39266740 CGGCGTACCCCGGGAGACCCCGG - Intronic
1118324658 14:64772912-64772934 GGACTTTGCCCGGGAGACCGGGG - Exonic
1121645918 14:95516829-95516851 CTGCGTGGCCCCGGGGACCAGGG + Intronic
1132597666 16:760712-760734 CGGCTTTGCCCGGGGCAGCAGGG - Intronic
1132950540 16:2559860-2559882 GGGAGGTGCCCGGGAGAGCACGG + Intronic
1132963808 16:2640310-2640332 GGGAGGTGCCCGGGAGAGCACGG - Intergenic
1141979417 16:87540837-87540859 CGGCGTTGCTGGGTAGACCCTGG - Intergenic
1143684945 17:8506279-8506301 CTGCGCTGCACGGGAGCCCATGG - Intronic
1144764207 17:17724125-17724147 CGCCGGCGCCCGGGAGACCCAGG + Exonic
1146339703 17:32007984-32008006 CGGCGATGCCGAGGAGACCCAGG + Intronic
1157661291 18:49447444-49447466 CAGCTTTGTCCGGGATACCAAGG + Intronic
1160622055 18:80178620-80178642 CGGCGTTGCTAGGGAGACTGGGG - Intronic
1161345534 19:3767189-3767211 CCGAGGTGCCCGGGACACCAGGG + Intronic
1163104153 19:15114017-15114039 AGGCGGTGCCCTGGTGACCAAGG + Exonic
1163885222 19:19959361-19959383 TGGCGTTACCCGCTAGACCAAGG + Intergenic
1166313347 19:41975595-41975617 AGGGGTGGCCCTGGAGACCAGGG - Intronic
1166584681 19:43935272-43935294 CGGAAGTGCCCGGGAGAGCAGGG + Intronic
1167271717 19:48509973-48509995 TGGCCTTTCCCGGGACACCATGG + Intronic
1167587436 19:50382914-50382936 CCCCCTAGCCCGGGAGACCAGGG + Exonic
1168714719 19:58520010-58520032 CGGCGTCGCCCAGGAGATCAGGG + Exonic
926113205 2:10195582-10195604 CCGCGTTTACCTGGAGACCAAGG + Intronic
929047446 2:37803722-37803744 CGGCCTAGTCCAGGAGACCATGG + Intergenic
931265954 2:60660665-60660687 CGCCTGTGCCCGGGAGACAATGG + Intergenic
941951492 2:171160827-171160849 CGGCGTCGCCCGGGAGGCGGCGG + Exonic
946336277 2:219038745-219038767 GGGCTTTGCCTGGGAGCCCAGGG + Intronic
947399107 2:229714563-229714585 CGCCGTTGCCCGGGGAACCGCGG - Intergenic
1170859680 20:20091070-20091092 CGGGGTGGCCAGGGAGACAATGG - Intronic
1174183563 20:48689989-48690011 AGGTGTTGCAGGGGAGACCAGGG + Intronic
1176062609 20:63178912-63178934 CGGCGGGGCCCGGGAGACAAAGG + Intergenic
1180929615 22:19579972-19579994 CGGCCAGGCCCGGGAGAACATGG - Intergenic
1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG + Exonic
954186256 3:48919095-48919117 CGCCGTCGCCCGGGAGGCCCGGG + Exonic
954356961 3:50089554-50089576 CGGCACCGCCCGGGAGACAAGGG + Intronic
955473702 3:59313572-59313594 CAGCGCTGCCTGGGAGGCCAGGG + Intergenic
975361641 4:73477423-73477445 CGAGGTTGCCCAGCAGACCAAGG + Intergenic
997735470 5:136209573-136209595 TGGCTGTGCCTGGGAGACCACGG + Intergenic
1022524558 7:31028781-31028803 CCGCGTTGCCCGGGAGACCACGG - Intergenic
1023846480 7:44123712-44123734 CCGCGTTGCCCAGGAAACCGAGG - Intronic
1026833425 7:73623530-73623552 CGCCGGTGCCCGGGAGGCCTGGG - Intronic
1042868771 8:73378826-73378848 GGGGGTAGCCAGGGAGACCAAGG + Intergenic
1049601615 8:143510368-143510390 CGGCCTGGCCCTGCAGACCATGG + Intronic
1056404561 9:86261386-86261408 CCCCGTTGCTCAGGAGACCAAGG - Intergenic
1057693421 9:97307302-97307324 CCGCGTTGCCTTGGAGACCATGG + Intronic
1062381842 9:136290525-136290547 AGGGGTGGTCCGGGAGACCACGG + Exonic
1062538234 9:137030239-137030261 GGGCGGGGCCCAGGAGACCACGG - Exonic
1186356746 X:8799390-8799412 CTGCGTGGCCCGGAGGACCACGG + Intronic
1186357073 X:8800505-8800527 CTGCGTGGCCCGGAGGACCACGG + Intronic
1186407518 X:9317015-9317037 CTGCATTGCCAGGGAGGCCAAGG + Intergenic
1186496350 X:10015243-10015265 CGGCGCGGCCCGGGCGAGCAGGG - Intergenic
1187737052 X:22315548-22315570 CTGCGTTCCCCTTGAGACCAAGG + Intergenic
1189320430 X:40083973-40083995 CGGCGTTTCCCGGGAGGTCTCGG - Intronic
1200109653 X:153733864-153733886 GGGCCTGGCCCGGGAAACCAGGG - Intronic