ID: 902991090

View in Genome Browser
Species Human (GRCh38)
Location 1:20187367-20187389
Sequence GTGGTGAAGTGAACTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902991081_902991090 27 Left 902991081 1:20187317-20187339 CCTAGATCTTGTCAAATCGGTTT 0: 1
1: 0
2: 1
3: 7
4: 68
Right 902991090 1:20187367-20187389 GTGGTGAAGTGAACTGAGCAGGG 0: 1
1: 0
2: 1
3: 28
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902991090 Original CRISPR GTGGTGAAGTGAACTGAGCA GGG Intronic
900474853 1:2871252-2871274 GTGGGGAGGTGAACTGAGACAGG + Intergenic
900486888 1:2926905-2926927 GTGCTGAACTGAGCTGAGCTGGG + Intergenic
901107125 1:6765173-6765195 GTGGAGAAAGGAAGTGAGCAGGG - Intergenic
901164019 1:7203449-7203471 GTGGTAAAGCGACCTGGGCATGG + Intronic
901310744 1:8267667-8267689 GTTCTGAAGTGAACTGACTAGGG + Intergenic
902058674 1:13623339-13623361 GTAGTCAAGTGAAAAGAGCATGG + Intergenic
902991090 1:20187367-20187389 GTGGTGAAGTGAACTGAGCAGGG + Intronic
903364392 1:22797095-22797117 ATGGTGAAGTGACCTGCCCAAGG + Intronic
903466901 1:23558307-23558329 TTGGTGAAGTCAAGTGGGCAGGG + Exonic
903546269 1:24125267-24125289 GAGGTTAAGTGACCTGACCAAGG + Intronic
904833516 1:33320539-33320561 GTGGAGGAGTGGACTGATCAGGG - Intronic
904855643 1:33496396-33496418 TTGGTGAAGTGATTTGAGCAAGG + Exonic
904868303 1:33600141-33600163 GTGGGGAAGGGACCTGTGCAAGG + Intronic
905334944 1:37238759-37238781 GTGGTGAAGTGATTTGGCCAAGG - Intergenic
906555675 1:46710912-46710934 GTTGTTAAGTGAAATGAGCTGGG - Intronic
906682287 1:47737000-47737022 GTGGTGAAGTGATCTGTTCAAGG - Intergenic
907309470 1:53531035-53531057 GTGGTCAAGTGACCTGCCCAAGG + Intronic
907645137 1:56234893-56234915 ATGGTGAAGTAAAAAGAGCACGG - Intergenic
908395351 1:63720276-63720298 GTGGTCAAGTGAAAAGACCAGGG + Intergenic
908824536 1:68120553-68120575 GAGGTGAAGTGACCTGTGCAAGG - Intronic
912810226 1:112788586-112788608 ATGGTGAAGTGATCTGCTCAGGG + Intergenic
913084619 1:115425304-115425326 GTGGAGAAGTGCATTTAGCATGG + Intergenic
913437688 1:118864292-118864314 CTGGTTAAGTGAAGTGAGTATGG + Intergenic
915475324 1:156149769-156149791 GTGGGCAAGGGAGCTGAGCAGGG + Intronic
915578973 1:156801954-156801976 GTGGTGAGGTGTGCTCAGCAGGG + Intergenic
915742654 1:158131039-158131061 GAGGTGAAGGGAAGTGAACAGGG + Intergenic
916262544 1:162856782-162856804 TTTGTGAAGTGATCAGAGCAAGG + Intronic
916550969 1:165849523-165849545 GAGGTGAAGTGAGATGAGGAAGG + Intronic
916745305 1:167680529-167680551 GTGGTGCAGTGATGTGAGCAGGG + Intronic
917089348 1:171337166-171337188 CTGGTTAAGTGAACTGGGCGGGG + Intronic
917455210 1:175180157-175180179 ATGGTGAAGGGCACAGAGCAGGG - Intronic
919006439 1:191904803-191904825 ATTGGGAAGTGAACTGAACAAGG - Intergenic
919782188 1:201228300-201228322 GTGGTGAAGAAAACTCAGAATGG - Intronic
920097299 1:203494491-203494513 GTGGGGAGGTTAACTGGGCATGG + Intronic
920113335 1:203602346-203602368 GTAGTGAAGTGACCTGCCCAAGG - Intergenic
920667120 1:207971341-207971363 ATGGTGAATTCAAGTGAGCAGGG - Intergenic
920709641 1:208282777-208282799 GTGCTGTAGTGTACTGTGCATGG + Intergenic
922342915 1:224671786-224671808 TTGGTGATGGGAGCTGAGCAAGG + Intronic
922787828 1:228291962-228291984 GTTGTGGTGTGAACTGAGCAAGG + Exonic
922989843 1:229897201-229897223 GTGGTTAAGTGACCTGAGGAGGG + Intergenic
923362070 1:233221633-233221655 ATGGGGAAGAGAACAGAGCAAGG + Intronic
924290661 1:242533473-242533495 GAGGTGAAGTGAACTGCTCAAGG + Intergenic
1063504511 10:6583730-6583752 GAGATGAAGTGAACTGAATAGGG - Intergenic
1064477378 10:15705776-15705798 GAGGTGAAGTGAAATGAGGATGG - Intronic
1064625106 10:17253509-17253531 GTGGTGAATTGAACAGAGATAGG + Intergenic
1065066737 10:21975579-21975601 GTGGCAAATTGAACTGTGCAAGG + Intronic
1067427079 10:46218575-46218597 ATGGTGGAGTGAGCTGAGGATGG + Intergenic
1067427110 10:46218746-46218768 ATGGTGGAGTGAGCTGAGGATGG + Intergenic
1067427118 10:46218784-46218806 ATGGTGGAGTGAGCTGAGGATGG + Intergenic
1067427135 10:46218879-46218901 ATGGTGGAGTGAGCTGAGGATGG + Intergenic
1067427153 10:46218955-46218977 ATGGTGGAGTGAGCTGAGGATGG + Intergenic
1067427167 10:46219012-46219034 ATGGTGGGGTGAGCTGAGCATGG + Intergenic
1067582592 10:47454842-47454864 ATGGTGGAGTGAGCTGAGGATGG + Intergenic
1068234279 10:54212803-54212825 TTTGTGAAGTGAAAAGAGCATGG + Intronic
1069628980 10:69886199-69886221 TTGTTGAACTGAACTGAACAGGG - Intronic
1070018309 10:72557305-72557327 GTGATGAACTGAACTGACCTTGG - Intronic
1070577405 10:77689648-77689670 CTGATGAACTGAACTGAGCTGGG + Intergenic
1070839992 10:79478703-79478725 GTGGTGAGGTGAACAGATCTGGG - Intergenic
1072713877 10:97736698-97736720 GGTGTGAAGTGAACTGAGCTGGG + Intergenic
1073436214 10:103517811-103517833 TTGGTGAAGTGGCCTGGGCAAGG - Intronic
1074036110 10:109740454-109740476 GTGGAGGAGAGAACTCAGCATGG + Intergenic
1076310135 10:129500266-129500288 GTGGTGGGGTGAACTGGGCGGGG + Intronic
1076738039 10:132467486-132467508 GTGGGGGCGTGAGCTGAGCAGGG + Intergenic
1078492403 11:11781617-11781639 GTGGGGAATTGAGCTGAGCATGG - Intergenic
1078937665 11:15965790-15965812 GTAGTGGGGTGAAGTGAGCAGGG - Intergenic
1079138912 11:17794698-17794720 GAGATGACGTGAACTGTGCAAGG + Intronic
1079316487 11:19411939-19411961 GTGGTGAAGTCATCTGCCCAAGG + Intronic
1079677147 11:23243464-23243486 GCAGGGATGTGAACTGAGCATGG - Intergenic
1083301277 11:61740762-61740784 GTGGTGATGTGGACAGAGCCAGG - Intronic
1084751813 11:71209112-71209134 GTGGTGAAATGAGCAGAGCCAGG - Intronic
1085985279 11:81779656-81779678 ATGATGTAGTGAAATGAGCACGG + Intergenic
1086046624 11:82540366-82540388 GTTGTTAAGTGAAATGAGCCAGG + Intergenic
1086157724 11:83686180-83686202 CTGCTGAAGGGAGCTGAGCAAGG - Intronic
1088329635 11:108637514-108637536 GTGGTGAAGTATTGTGAGCAGGG + Intergenic
1089272979 11:117314863-117314885 GAGGGGAACTGAACTGAGCCTGG - Intronic
1089324002 11:117644823-117644845 GTGGTCAAGGGATCTCAGCAGGG + Intronic
1089633839 11:119799812-119799834 GCGGTGACATGAATTGAGCAGGG - Intergenic
1089711286 11:120316714-120316736 GTAATGAACTGAACTGGGCATGG - Intronic
1090474562 11:127007863-127007885 GAGGTGAAGTGAACTTCTCATGG - Intergenic
1092053632 12:5491137-5491159 GTGGTGAAGTGAGCTGTCTAAGG - Intronic
1097977128 12:65698633-65698655 GAGGTGTAGTGAACAGAACAAGG - Intergenic
1098957194 12:76699668-76699690 ATGGTGTAGTGAAATGAGCAAGG + Intergenic
1100410506 12:94313372-94313394 GTGTTTAAGAGAACTGAGCCAGG + Intronic
1100815033 12:98378673-98378695 TGGGTGAAGTGAAGTGGGCAAGG - Intergenic
1101761931 12:107665753-107665775 GTTGTGAAGTGAACAGGGAAGGG - Intergenic
1102190684 12:110985702-110985724 GAGGTTAAGTGACCTGTGCAAGG + Intergenic
1102698339 12:114817468-114817490 GCCGGGAAGTGAACTGGGCAAGG + Intergenic
1104339644 12:127936145-127936167 GTTGGGATGGGAACTGAGCATGG + Intergenic
1104382139 12:128316346-128316368 GTGGGGAAGGAAACTGAGGAAGG - Intronic
1104793189 12:131496932-131496954 GTGGAGCAGAGAACTGAGAAAGG + Intergenic
1106067500 13:26369500-26369522 GTGGTGCACTGAACTGAGGTTGG + Intronic
1107052485 13:36066497-36066519 GTGCTGTAATGAACTTAGCATGG + Intronic
1107698051 13:43020080-43020102 GAGGTGAGGTGGACTCAGCAGGG - Intergenic
1109300588 13:60586384-60586406 GAGGTGAAGTGAAATGACCCAGG - Intergenic
1111404387 13:87783621-87783643 GTGGTGATGTGAACAGGGCATGG + Intergenic
1115662321 14:35509009-35509031 GTGGTAAAATGCACTGAGCTAGG + Intergenic
1119649382 14:76372940-76372962 GTGGTGAAGTGACCTACCCAAGG - Intronic
1119672908 14:76533079-76533101 GTGGTGAAGGTTGCTGAGCATGG - Intergenic
1119881904 14:78106361-78106383 ATCGTGAAATGAACTGAGCAAGG + Intergenic
1122704287 14:103610300-103610322 GGGGTGACGTGAGCTGGGCATGG + Intronic
1125943847 15:43697701-43697723 GTGGTAAACTGAACTGAGAGAGG - Intronic
1126878164 15:53066412-53066434 GTGGTTAAGTGATCCGTGCAAGG + Intergenic
1127304510 15:57691504-57691526 GTGCTGTAGTGACCTGACCAAGG - Intronic
1128471206 15:67955138-67955160 GTGATGAAATTAGCTGAGCATGG + Intergenic
1128695550 15:69759348-69759370 GAGGTGAAGTGACCTGCCCAAGG - Intergenic
1132298917 15:100764382-100764404 GTGCCGAAGTGACCTGGGCAAGG + Intergenic
1132311203 15:100859226-100859248 GTGGTGAAGTGTGCTCAGCCAGG + Intergenic
1134169435 16:11956824-11956846 GGGGTGAAGCCAACTGAGCATGG - Intronic
1136042514 16:27591536-27591558 GAGGTGAAGTGACTTGACCAAGG - Intronic
1136084913 16:27877879-27877901 ATGGTGAAGTGTTCTGAGCAGGG - Intronic
1136539393 16:30920906-30920928 GTGGAGAAGTGAGATGGGCATGG + Intergenic
1137576094 16:49601282-49601304 GAGGTGAAGTGACCTGCCCAAGG - Intronic
1138413676 16:56858973-56858995 GTGGTGTGGTGAACGGTGCAAGG - Intergenic
1139245717 16:65441307-65441329 GTGGTGGTGTGATCTGATCATGG - Intergenic
1139264924 16:65629659-65629681 GTGTTGGAGTTAAATGAGCATGG - Intergenic
1139494940 16:67309567-67309589 GTGATGCAGTCCACTGAGCATGG - Intronic
1140846027 16:78888975-78888997 GTGGTGAGGAGGACTGACCAGGG - Intronic
1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG + Intergenic
1141715800 16:85726154-85726176 GCTGTGAAGGGAATTGAGCAAGG - Intronic
1141717858 16:85737112-85737134 GTGGGGAAGTGATCTGTGCTGGG + Intronic
1142117880 16:88369548-88369570 GAGGTGAAGTGACTTGCGCAGGG - Intergenic
1144581077 17:16459942-16459964 GTGTTGAAGTGGTCTGAGGAAGG + Intronic
1144581245 17:16460675-16460697 GTAATCAAGTGATCTGAGCAAGG - Intronic
1147283286 17:39380587-39380609 GGGGGGAAGGGAGCTGAGCATGG - Intronic
1147563818 17:41524591-41524613 GTGGGGAAGTGACCTGGGCCAGG - Intronic
1149428879 17:56580990-56581012 GAGGTCAAGTGACCTGACCAAGG - Intergenic
1149450612 17:56747391-56747413 GAAGTGAAGTGAACTGCTCATGG - Intergenic
1149699904 17:58646753-58646775 GAGCTGAAGTGTACTGAGAAGGG - Intronic
1153365027 18:4246473-4246495 GGGGTGCAGAGAACTCAGCAGGG + Intronic
1153795617 18:8619218-8619240 GAGGAGAAGTGACCTGGGCATGG + Intronic
1154055205 18:11006168-11006190 GTGGTGAAGTGTACAAAACAGGG - Intronic
1155146991 18:23092501-23092523 GTGATTTGGTGAACTGAGCAGGG - Intergenic
1155456528 18:26021396-26021418 ATGGTACAGTGAACAGAGCATGG + Intronic
1156173744 18:34517584-34517606 GAGGGGAAGAGAAATGAGCATGG - Intronic
1158496709 18:57961612-57961634 GTGGTGAAGTCAACTGTGAAAGG + Intergenic
1158904285 18:61997114-61997136 GTGTTCCAGTGAACTGAACAGGG + Intergenic
1160354700 18:78216887-78216909 GTGGTCACTGGAACTGAGCATGG - Intergenic
1160669433 19:352349-352371 GTGGGGAAGTGAAGGCAGCAGGG + Intergenic
1162450137 19:10749484-10749506 GGGGTGAAGTGACTTGAGCCAGG + Intronic
1167561746 19:50230341-50230363 GTGCTTAAGTGACATGAGCACGG + Intronic
926315683 2:11707958-11707980 CTGGGGAAGTGAACTGAACTGGG + Intronic
930086273 2:47499547-47499569 ATGGTGTAGTGAAATGAGAAAGG + Intronic
931215942 2:60244880-60244902 GAGGTTAAGTGAACTGTGCAAGG + Intergenic
931920535 2:67010189-67010211 GTGGTCAGCTGAACTGAACACGG + Intergenic
932834284 2:75020814-75020836 GTAGGGAAGTGAGATGAGCAAGG - Intergenic
935416447 2:102824173-102824195 GTGATGTAGTCAACTGAGCCAGG - Intronic
935452995 2:103232693-103232715 TTGGTTAAGTGAAGTGAGGATGG + Intergenic
937194734 2:120143156-120143178 CTGGTGAAGTGAAATGAGCATGG + Intronic
937910116 2:127071475-127071497 GTGGTGAAGCTCCCTGAGCAGGG + Intronic
939846352 2:147251133-147251155 GAGGTTAAGTAACCTGAGCAAGG + Intergenic
942267445 2:174242546-174242568 GCTGTGAAGTGAAAGGAGCATGG + Intronic
945276864 2:207996898-207996920 GTGTTCAAGTGTACTGAACATGG + Intronic
946400239 2:219464813-219464835 GTTGTGTAGTAAGCTGAGCACGG - Intronic
947708626 2:232296269-232296291 CTGGTGAGGTGAAAGGAGCATGG + Intronic
1169398972 20:5263429-5263451 GTGATGAATTAAAATGAGCAAGG + Intergenic
1172023482 20:31932559-31932581 GTGGTGTATTGAACAGAGTAGGG - Intronic
1172539201 20:35698271-35698293 GCGCTGAAGTGATCTGACCAAGG + Intronic
1172625480 20:36344223-36344245 GAGGTGAAGTTAACTGCTCAAGG - Intronic
1173620749 20:44434180-44434202 GTGGTGGAGTGACCTGCCCAAGG - Intergenic
1173812686 20:45965837-45965859 GTAGGGAAGTGAGCTGGGCAAGG - Intronic
1173998841 20:47359673-47359695 GAGGTGAAGTGAGCTGCCCAAGG + Intergenic
1174185653 20:48704147-48704169 GTGGTGAAGTGACTTGTTCATGG + Intronic
1174560165 20:51425462-51425484 GTGCTGATGAGAACTGAGCCAGG - Intronic
1174722662 20:52830118-52830140 GTGGAGAGGTGAAGTCAGCATGG + Intergenic
1175430795 20:58901642-58901664 GTGGTGCAGTGACCTGTGAAAGG + Intronic
1175766137 20:61594180-61594202 GTGGGGGACTGACCTGAGCAGGG + Intronic
1175770972 20:61624091-61624113 TCTGTGAAGTGAAGTGAGCACGG + Intronic
1176049220 20:63107847-63107869 GTGGGGCAGAGAACTGAGGAGGG + Intergenic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1181337765 22:22153783-22153805 GTGGTGGAGTGAGCCGAGCTGGG + Intergenic
1181482282 22:23207891-23207913 GGGGTGTAGGGCACTGAGCAGGG - Intronic
1181987052 22:26807061-26807083 TTGGTGGAGGGCACTGAGCAGGG + Intergenic
1182407954 22:30153966-30153988 TTGGTGAAATAAACTGTGCAAGG - Intronic
1182438130 22:30344209-30344231 GAGGTGCAGTGAAGTTAGCATGG - Intronic
1182449938 22:30413723-30413745 GGAGTGAAGTGAACTCATCAGGG + Intronic
1183028118 22:35081608-35081630 GTGGGGAAGGGAACTGGGCAGGG + Intronic
1184005654 22:41706556-41706578 CTGTTGAAGTGGACTGAGCATGG + Intronic
1184029586 22:41884071-41884093 GAAGTGACGTAAACTGAGCAAGG - Intronic
1184493553 22:44824374-44824396 GTGGTGCACTGGACTGAGCCTGG - Intronic
1185025576 22:48408738-48408760 GTGGTGAAGGGATGTGAGGATGG - Intergenic
950377084 3:12580788-12580810 GTGGTGAAGTTCTCTGAGGACGG - Intronic
950502321 3:13372352-13372374 GTGCTGAAGTGCACTGTGCAGGG + Intronic
950508985 3:13414398-13414420 CTGGTGAAGGGAGTTGAGCAAGG + Intronic
955274979 3:57538689-57538711 GTGAGCAAGTGAACTGAGAAAGG - Intronic
955997599 3:64693331-64693353 GTGGGGAGGTTAACTGAGAAAGG - Intergenic
956050199 3:65239910-65239932 GTGGTCAAGTGAAGACAGCACGG - Intergenic
956190646 3:66604826-66604848 TTGGTGAGGTGATCAGAGCAAGG - Intergenic
956457393 3:69436129-69436151 CTGGTGAAGTAAGCTGAGAAAGG - Intronic
956538734 3:70309611-70309633 GTGGTGCAGTAAAAAGAGCATGG - Intergenic
956625120 3:71259276-71259298 GAGGTGAAGTGAGCTCTGCAAGG - Intronic
961166162 3:124765335-124765357 GTGGTGCTGGGAGCTGAGCATGG + Intronic
962478705 3:135780066-135780088 GTGGTGACGGGAACTTGGCAGGG - Intergenic
963759843 3:149276680-149276702 CTGGAGAAGTTAACTGAGTAGGG + Intergenic
963876423 3:150480536-150480558 GTGGTAAAGTGACTTGTGCAAGG - Intergenic
963960563 3:151304646-151304668 GTGGTGGAGTGTATAGAGCAAGG + Intronic
964041466 3:152267216-152267238 GTGGAGAAGAGAAAAGAGCAGGG - Intronic
964335857 3:155653612-155653634 GTGATGAAATGAACTGACAAGGG - Intronic
964427896 3:156572560-156572582 GTCCTGAAGAAAACTGAGCAGGG + Intergenic
965655317 3:170977089-170977111 GAGGTCAAGTGAATTGTGCAAGG - Intergenic
966025605 3:175276862-175276884 GTGGTGAGGTGAAGTGAGTTGGG - Intronic
967477053 3:189934219-189934241 GTGGTGAAGGGGAGTGATCAGGG - Intergenic
967725251 3:192856326-192856348 GTAGTGAAGTGATCTGCTCAAGG - Intronic
968820489 4:2846783-2846805 GTAGTGCAGTGAAGTGATCATGG - Intronic
969955043 4:10880493-10880515 GACATGAAGTGAACTGGGCATGG - Intergenic
971154711 4:24068934-24068956 GAGCTGTAGTGAAATGAGCATGG + Intergenic
972436536 4:39040756-39040778 GTGGTGAAGAGAGCTGAGGCTGG + Intergenic
973613115 4:52656440-52656462 GTGGGGGATTGACCTGAGCAGGG + Intronic
975755176 4:77564823-77564845 GTGGAGAAGTGAAAAGAGAAAGG + Intronic
975857862 4:78643518-78643540 GTGGTAGAGTGGAATGAGCATGG - Intergenic
975979841 4:80144888-80144910 GTGGGGAAGTGAGATGAGGAAGG - Intergenic
977082164 4:92544663-92544685 GAGGTAAAGTGACCTGACCAAGG + Intronic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
979166569 4:117539917-117539939 GTGGTGACATGAAGTAAGCAGGG + Intergenic
979432673 4:120649872-120649894 TTAGTGAATTGAACTAAGCATGG - Intergenic
980532169 4:134070408-134070430 GTGGTGAACTGGCCTGTGCAAGG + Intergenic
984446915 4:179848954-179848976 GTGGTGGGGTGAGGTGAGCATGG - Intergenic
985181584 4:187270781-187270803 TTGTGGAAGTGATCTGAGCAGGG - Intergenic
985787096 5:1902156-1902178 GAGGGGAAGTGCACTGCGCATGG + Intergenic
985964880 5:3332270-3332292 TTGGTGCAGTGTACTGAGTAAGG + Intergenic
986797946 5:11230917-11230939 GCAGTGAGGTGAACTGAGGAGGG - Intronic
987119700 5:14755375-14755397 GTGGGGAAGTGACCTGTGAATGG + Intronic
988289140 5:29262469-29262491 GTGATGAAGTGAACTGAAATGGG + Intergenic
991051217 5:62274246-62274268 GGGGTTAAGTTAACTGATCAGGG + Intergenic
991499230 5:67259637-67259659 GTGGTGAAGCACGCTGAGCAAGG + Intergenic
992523643 5:77583652-77583674 GTGGTGAGGTCAACTGGGCCTGG - Intronic
992928358 5:81615006-81615028 TTGGGGAAGTGAATTCAGCAGGG + Intronic
996729710 5:126705282-126705304 TTGGTGAACTGAACTGAGGAAGG - Intergenic
1000954640 5:167528370-167528392 GTGGTAATGTGAACAAAGCATGG + Intronic
1001400685 5:171444668-171444690 GTGGTGAAGGGCACTGACCATGG + Intronic
1001588664 5:172850594-172850616 GAGGTGAAGTGAGCTGCCCAAGG - Intronic
1001752973 5:174145583-174145605 GTGGACTAGGGAACTGAGCAAGG + Intronic
1001813685 5:174649965-174649987 GAGGTGAAGTGACTTGACCAAGG + Intergenic
1002128228 5:177062860-177062882 GTGGTGATGTGAATGAAGCAAGG + Intronic
1002663525 5:180806698-180806720 GTTGTGAGGAGAACAGAGCAGGG - Intronic
1003240557 6:4341746-4341768 GTGGTGAAGAAAACAGAACATGG - Intergenic
1005972336 6:30771111-30771133 GTGGAGAAGGCATCTGAGCAGGG - Intergenic
1006577116 6:35054652-35054674 GTGATGAAGTAAACTGAGTCAGG - Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1007112176 6:39319294-39319316 GTGGCTAAGTGACCTGTGCAAGG + Intronic
1007132901 6:39493331-39493353 GTGGTTAAGTGACCTGCCCAAGG + Intronic
1007278499 6:40693014-40693036 GTGGTGAACTGAACTGAGATGGG - Intergenic
1007946915 6:45835216-45835238 GTGGTAATGTCGACTGAGCAAGG + Intergenic
1011174797 6:84548516-84548538 GAGGTGGAGTGCAGTGAGCAAGG - Intergenic
1011633236 6:89347441-89347463 CTGTTGAACTGAACTGAGTAGGG - Intronic
1013034241 6:106364640-106364662 GTGGTGTGGTGGAATGAGCATGG + Intergenic
1014492565 6:122080998-122081020 GTGCTGATGTTCACTGAGCATGG + Intergenic
1014583667 6:123170285-123170307 ATGGTGAAGTGAAAGGAGCATGG + Intergenic
1015390303 6:132674381-132674403 GTGGTAGAATGCACTGAGCAAGG + Intergenic
1016934062 6:149436041-149436063 GTCGTGACGTGACCAGAGCAGGG + Intergenic
1017442046 6:154473766-154473788 ATAGTGGAGAGAACTGAGCATGG - Intronic
1018629582 6:165810445-165810467 ATGGTGAAGTGAATTAAGCAGGG - Intronic
1019615580 7:1958242-1958264 GTGGAGAAGGGAACTCACCATGG - Intronic
1020437181 7:8176929-8176951 GTGGTTTAGTGAAATGAGCAGGG - Intronic
1020485373 7:8714413-8714435 GTGGGGAAGAGCACTAAGCAGGG - Intronic
1021041160 7:15864169-15864191 TTGGAGCAGTGAACTGACCAAGG + Intergenic
1022864849 7:34406743-34406765 GTGGTGAAGTCAGTGGAGCAGGG - Intergenic
1023768170 7:43531313-43531335 GTGGTGAAGAGAAGTGCACAGGG - Intronic
1024364367 7:48504346-48504368 GCGGAGAGGTGAGCTGAGCAGGG + Intronic
1026291954 7:69015242-69015264 GGGGGGAAGGGAACTTAGCAAGG - Intergenic
1027258075 7:76443969-76443991 GTGGTTAAGGGCACTGAGCCAGG + Intergenic
1027280772 7:76608052-76608074 GTGGTTAAGGGCACTGAGCCAGG - Intergenic
1028215678 7:88129724-88129746 GTGGTGAAATGAATGGTGCATGG + Intronic
1028297980 7:89159347-89159369 CTGTTAAAGTGAATTGAGCAAGG + Intronic
1029295974 7:99540811-99540833 GTGGTGATGAGAGCTGAGCTTGG + Intergenic
1031152285 7:118068098-118068120 TTTGTGAAGTGAACTGAGTTTGG - Intergenic
1032288753 7:130566939-130566961 GTGGTGCAGTGAACATAGGAGGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1035463329 7:159060027-159060049 GTGGGTAAGTGAAGTGAGGATGG - Intronic
1035941446 8:3905770-3905792 GTGGTGAAGAATTCTGAGCAAGG - Intronic
1038077386 8:24091605-24091627 CTGGTGAAGTGGAGTGAGCAAGG + Intergenic
1038381024 8:27094493-27094515 GAGGTGAAGTGAGGAGAGCAAGG - Intergenic
1041005310 8:53492395-53492417 GTGGTGAAGCCAACAGATCAGGG + Intergenic
1041234936 8:55791112-55791134 GCTGTGAAGAAAACTGAGCAAGG - Intronic
1041330623 8:56719895-56719917 GTGGTGAAGTGAGCAGATGAGGG + Intergenic
1042874292 8:73426578-73426600 AATGTGAAGTGAAATGAGCAGGG - Intronic
1045391370 8:101718337-101718359 GTGGTGGAGTGAAGTCAACAGGG + Intronic
1045397055 8:101771663-101771685 GTTTTGAAGTGAAATGGGCAAGG + Intronic
1045653161 8:104361607-104361629 GGGGTGAAGTGAAGTGACCAAGG - Intronic
1046446179 8:114323004-114323026 GTGTTAAAGTGATCTGAGCTGGG + Intergenic
1046671011 8:117056328-117056350 GTGGTGATGGAAAGTGAGCAGGG - Intronic
1046811785 8:118540918-118540940 GTGGACATGTGACCTGAGCAGGG + Intronic
1047563865 8:126019620-126019642 GAGCTGGAGTGCACTGAGCAAGG + Intergenic
1047761507 8:127958050-127958072 GTGGTGAGGTGAAGGGAACACGG + Intergenic
1048085979 8:131180053-131180075 GTGGTGAGGTTTACTGCGCAGGG + Intergenic
1053140668 9:35680667-35680689 GTGGTGGAGTGCACTGAGGCAGG + Intronic
1053200507 9:36148797-36148819 GTGGTGAACTGAAGTCAGCCTGG - Intronic
1055770522 9:79711915-79711937 GTGGTGCAGTCAACAGAGTATGG + Intronic
1056164042 9:83924738-83924760 CTGGTAAAGTGGACTGGGCATGG - Intergenic
1056523180 9:87418861-87418883 AGGGAGAAGAGAACTGAGCAAGG - Intergenic
1057919627 9:99086353-99086375 GTGGAGAAGTGTACTGAGGCAGG + Intergenic
1058536251 9:105963337-105963359 ATGGTGCAGTGAAAAGAGCAAGG - Intergenic
1060033945 9:120239036-120239058 GTAGTGAAGAGTTCTGAGCAGGG - Intergenic
1060083643 9:120676994-120677016 GAAGTGAAGTGAAATGAGGAAGG - Intronic
1060302711 9:122384651-122384673 GAGGTGAAGTGAACTCTCCAGGG + Intronic
1060321970 9:122570942-122570964 GAGGTGAAGTGATCTGTTCAAGG + Intergenic
1060405639 9:123371692-123371714 GAGGTGAAGTGACCTGCCCAGGG + Intronic
1060745649 9:126129183-126129205 GTGGGGTAGAGAACTGGGCAGGG - Intergenic
1062069447 9:134547699-134547721 GGGGTGAAGGGAATTGAGAATGG - Intergenic
1062108374 9:134768031-134768053 GTGTTGATGTGAACAGACCAGGG + Intronic
1062173047 9:135145881-135145903 GCTGTGTAGAGAACTGAGCAGGG - Intergenic
1186598265 X:11007739-11007761 ATGGTGTAGTGAAAGGAGCATGG + Intergenic
1187383750 X:18828988-18829010 GTGGAAAAGTGAAAGGAGCAGGG - Intergenic
1187768447 X:22668926-22668948 ATGGAGAAATAAACTGAGCAAGG - Intergenic
1187843833 X:23515559-23515581 GTGGGGAAGTGAATTGGGGAAGG - Intergenic
1189309218 X:40008385-40008407 GTGGTGAAGGGAGCTGAACCTGG + Intergenic
1190176808 X:48157432-48157454 CTGTTGAAGAGAAATGAGCATGG - Intergenic
1190194484 X:48305339-48305361 CTGTTGAAGAGAAATGAGCATGG + Intergenic
1190310459 X:49113764-49113786 GAGGTGAAGTGGAATCAGCAAGG + Intronic
1190460967 X:50674901-50674923 GTGGTTAAGTGCACAGAGGACGG + Intronic
1190660986 X:52653964-52653986 CTGTTGAAGAGAAATGAGCATGG + Intronic
1190962430 X:55265847-55265869 GTGCTGAAGAGAAGTGAGTAGGG - Intronic
1191681728 X:63847642-63847664 GTGGAGGAGTGGAATGAGCACGG + Intergenic
1196634822 X:117990306-117990328 CTGCTGAACTGAACTGAGTAAGG + Intronic
1196758018 X:119174889-119174911 GTGTTCACATGAACTGAGCAGGG + Intergenic