ID: 902995430

View in Genome Browser
Species Human (GRCh38)
Location 1:20221304-20221326
Sequence CCACGCTGCCTTCCAGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902995430_902995434 1 Left 902995430 1:20221304-20221326 CCAGTAGCTGGAAGGCAGCGTGG No data
Right 902995434 1:20221328-20221350 TTGTGAAGAGGAGATCTAAAGGG No data
902995430_902995436 21 Left 902995430 1:20221304-20221326 CCAGTAGCTGGAAGGCAGCGTGG No data
Right 902995436 1:20221348-20221370 GGGAAACAAATAAATGGTCCTGG No data
902995430_902995435 15 Left 902995430 1:20221304-20221326 CCAGTAGCTGGAAGGCAGCGTGG No data
Right 902995435 1:20221342-20221364 TCTAAAGGGAAACAAATAAATGG No data
902995430_902995437 27 Left 902995430 1:20221304-20221326 CCAGTAGCTGGAAGGCAGCGTGG No data
Right 902995437 1:20221354-20221376 CAAATAAATGGTCCTGGAACAGG No data
902995430_902995433 0 Left 902995430 1:20221304-20221326 CCAGTAGCTGGAAGGCAGCGTGG No data
Right 902995433 1:20221327-20221349 ATTGTGAAGAGGAGATCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902995430 Original CRISPR CCACGCTGCCTTCCAGCTAC TGG (reversed) Intergenic
No off target data available for this crispr