ID: 902995866

View in Genome Browser
Species Human (GRCh38)
Location 1:20224174-20224196
Sequence CTTTCCCTCAGTCCGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902995861_902995866 -8 Left 902995861 1:20224159-20224181 CCTTCCCATTCTCCTCTTTCCCT No data
Right 902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG No data
902995857_902995866 4 Left 902995857 1:20224147-20224169 CCCACCTCTCTCCCTTCCCATTC No data
Right 902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG No data
902995854_902995866 14 Left 902995854 1:20224137-20224159 CCCTCAGATCCCCACCTCTCTCC No data
Right 902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG No data
902995860_902995866 -7 Left 902995860 1:20224158-20224180 CCCTTCCCATTCTCCTCTTTCCC No data
Right 902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG No data
902995859_902995866 0 Left 902995859 1:20224151-20224173 CCTCTCTCCCTTCCCATTCTCCT No data
Right 902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG No data
902995858_902995866 3 Left 902995858 1:20224148-20224170 CCACCTCTCTCCCTTCCCATTCT No data
Right 902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG No data
902995855_902995866 13 Left 902995855 1:20224138-20224160 CCTCAGATCCCCACCTCTCTCCC No data
Right 902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG No data
902995856_902995866 5 Left 902995856 1:20224146-20224168 CCCCACCTCTCTCCCTTCCCATT No data
Right 902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902995866 Original CRISPR CTTTCCCTCAGTCCGTGGTC TGG Intergenic
No off target data available for this crispr