ID: 902998478

View in Genome Browser
Species Human (GRCh38)
Location 1:20246929-20246951
Sequence CAGTGAAAACTAAATTAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902998478_902998480 -4 Left 902998478 1:20246929-20246951 CCAACTTAATTTAGTTTTCACTG No data
Right 902998480 1:20246948-20246970 ACTGACATGCCATTTCTTTAGGG No data
902998478_902998482 10 Left 902998478 1:20246929-20246951 CCAACTTAATTTAGTTTTCACTG No data
Right 902998482 1:20246962-20246984 TCTTTAGGGAACCCTGCCATAGG No data
902998478_902998479 -5 Left 902998478 1:20246929-20246951 CCAACTTAATTTAGTTTTCACTG No data
Right 902998479 1:20246947-20246969 CACTGACATGCCATTTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902998478 Original CRISPR CAGTGAAAACTAAATTAAGT TGG (reversed) Intergenic
No off target data available for this crispr