ID: 903003603

View in Genome Browser
Species Human (GRCh38)
Location 1:20283847-20283869
Sequence TCTTATCTTTAGAGTGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903003603_903003605 -4 Left 903003603 1:20283847-20283869 CCATCTCCACTCTAAAGATAAGA No data
Right 903003605 1:20283866-20283888 AAGAAAATCAAGCCTCAGAAAGG No data
903003603_903003606 4 Left 903003603 1:20283847-20283869 CCATCTCCACTCTAAAGATAAGA No data
Right 903003606 1:20283874-20283896 CAAGCCTCAGAAAGGAAAAATGG No data
903003603_903003608 27 Left 903003603 1:20283847-20283869 CCATCTCCACTCTAAAGATAAGA No data
Right 903003608 1:20283897-20283919 TCCCTACAAATAGCCAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903003603 Original CRISPR TCTTATCTTTAGAGTGGAGA TGG (reversed) Intergenic
No off target data available for this crispr