ID: 903007601

View in Genome Browser
Species Human (GRCh38)
Location 1:20308936-20308958
Sequence CTGTCTGCGGGGTAGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903007601_903007608 -10 Left 903007601 1:20308936-20308958 CCTGGCACCTACCCCGCAGACAG 0: 1
1: 0
2: 3
3: 4
4: 145
Right 903007608 1:20308949-20308971 CCGCAGACAGGAAAACCAGAGGG 0: 1
1: 0
2: 1
3: 8
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903007601 Original CRISPR CTGTCTGCGGGGTAGGTGCC AGG (reversed) Intronic
900013994 1:136711-136733 CTGTCCGCGTGGGAGGGGCCGGG + Intergenic
900244257 1:1630273-1630295 CCGTCTGCGGGGTGGGGGACGGG - Exonic
900279540 1:1857493-1857515 CTGTCTGCAGGCCAGGTGGCTGG + Intronic
900348693 1:2224669-2224691 CTGTCACCGTGGTAGGGGCCAGG + Intergenic
900421922 1:2559452-2559474 CCGTTTGCGGGGTGGGTGTCTGG + Intronic
900908392 1:5576827-5576849 GTTTCTGCGGTGCAGGTGCCTGG - Intergenic
901520047 1:9776625-9776647 CTGGCTGCCGAGTAAGTGCCGGG - Intronic
902447860 1:16478470-16478492 CTCTCTGCAGGGAAGGTGGCTGG + Intergenic
902469967 1:16642485-16642507 CTGGGTGTGGAGTAGGTGCCAGG + Intergenic
902506813 1:16944034-16944056 CTCTCTGCAGGGAAGGTGGCTGG - Intronic
903007601 1:20308936-20308958 CTGTCTGCGGGGTAGGTGCCAGG - Intronic
903651643 1:24926156-24926178 CTGACTGCGGGGCAGTGGCCAGG - Intronic
905884817 1:41485916-41485938 CTGTGTGCAGGGTAGGTGTCAGG - Intergenic
907051110 1:51330425-51330447 CTGCCCGCGGGGTAAGTGCGCGG - Intronic
908162677 1:61426476-61426498 CGGTTTGCGGGGGAGGTGCTGGG - Exonic
911094051 1:94041399-94041421 CTGCCTGCAAGGTAGGGGCCAGG + Exonic
913169394 1:116218688-116218710 CAGTCTGGGTGGTAAGTGCCAGG + Intergenic
917310073 1:173669633-173669655 CTGCCGGCGGGGTAGGAGACCGG + Intronic
920335703 1:205243766-205243788 GGGTCTGTGGGGTAGGGGCCTGG + Intronic
922937128 1:229431677-229431699 CTGTCGGCGGGGTGGGCTCCAGG - Intronic
1067683574 10:48454746-48454768 CTGTCTGCGGCCTTGGTCCCTGG - Intronic
1068526059 10:58131058-58131080 CTGTCGGCGGGGTAGAGGGCCGG + Intergenic
1069681960 10:70291761-70291783 CTGTCTCCATGGGAGGTGCCTGG - Intergenic
1069746450 10:70717793-70717815 CTGTCTGGATGATAGGTGCCTGG + Intronic
1070518440 10:77229483-77229505 CTGTCTGCCAGGCATGTGCCAGG + Intronic
1070977209 10:80614804-80614826 CTGGCCACAGGGTAGGTGCCTGG + Intronic
1071508163 10:86245334-86245356 CTGTCTGAGGGGTAGGTGCTGGG - Intronic
1071669119 10:87590692-87590714 CTGTTTGCGGGGAGGGGGCCTGG - Intergenic
1072068305 10:91891759-91891781 CTATCTAAGGGGTTGGTGCCTGG + Intergenic
1072226398 10:93374008-93374030 CTGTCAGCGGGATAGGGGGCTGG - Intronic
1075681719 10:124338178-124338200 CTGTCTGCAGGGTGAGTGCTGGG - Intergenic
1076075703 10:127532169-127532191 CTGTGTGCGGGGTCTGAGCCAGG - Intergenic
1076457203 10:130608695-130608717 CTGTCTGCGGGGCAAATGCAGGG - Intergenic
1076707618 10:132310227-132310249 CTGACTGAGAGGCAGGTGCCTGG - Intronic
1076970323 11:128876-128898 CTGTCCGCGTGGGAGGGGCCGGG + Intergenic
1077378052 11:2214847-2214869 CTGCCAGCGGGGCAGGTGGCAGG - Intergenic
1079475328 11:20823835-20823857 CTTTCTTCGGGGCAGGTGCAGGG - Intronic
1083399155 11:62411932-62411954 CTTTCTGTGGGAGAGGTGCCTGG - Intronic
1084564674 11:69922146-69922168 CTGTCTGCGGGGTCGGCGTGGGG + Intergenic
1085456618 11:76669085-76669107 CTGTCTGCAGGGTAGGCAGCTGG + Intronic
1089868830 11:121654990-121655012 CTGCCTGCCTGCTAGGTGCCCGG - Intergenic
1090485026 11:127105599-127105621 CTTGCAGCGGGGTAGGTGGCAGG + Intergenic
1091483090 12:854745-854767 CTGTCTGGGGAGTTGGTTCCAGG + Intronic
1091796541 12:3300563-3300585 ATGTCGGGGAGGTAGGTGCCTGG + Intergenic
1096707019 12:53428785-53428807 CTGTCTGCTGGGGAGATGCAGGG + Intronic
1097172977 12:57127973-57127995 CAGTCCGCGGGGAAGGTGCAGGG - Intronic
1098105783 12:67068696-67068718 CCGTCTGTGGGGTGGGTGCTGGG - Intergenic
1104661381 12:130613417-130613439 CTGCCTGCGGGGTGGGGGGCTGG - Intronic
1108484330 13:50909646-50909668 GGGTCTGCGGGGTGTGTGCCCGG - Intergenic
1108603146 13:52011887-52011909 CCGCCTGCGGGGAAGGTGCCCGG + Intergenic
1109044181 13:57387056-57387078 CGGTCTGGGGGGTGGGTCCCAGG - Intergenic
1109132407 13:58603808-58603830 CTTTCTGGAGGGCAGGTGCCAGG - Intergenic
1112860441 13:103824110-103824132 CTGTCGGTGGGGTAGGGGCTGGG - Intergenic
1113360432 13:109626065-109626087 ATGCCTGGGGTGTAGGTGCCTGG + Intergenic
1113478201 13:110600395-110600417 CAGTCTGCAGGGCAGGGGCCAGG + Intergenic
1120559087 14:85969181-85969203 CTGTTGGCAGGGTAGGGGCCTGG - Intergenic
1127572853 15:60261309-60261331 CTGTGTGCTAAGTAGGTGCCAGG - Intergenic
1127625045 15:60772205-60772227 CTGTCAGGGGGGTGGGGGCCTGG - Intronic
1128636373 15:69305166-69305188 GTGTCTGCTGGGTAGAAGCCAGG - Intronic
1129772608 15:78212501-78212523 CTGGCTGCGGGGCAGGAGGCGGG + Intronic
1131083281 15:89554643-89554665 CTGACTGCGAGGCAGGGGCCAGG - Intergenic
1131520347 15:93109772-93109794 CGCTCTGCGGGGGAGCTGCCGGG - Intergenic
1132645790 16:998719-998741 CTGCCTCCTGGGTAGGTGCAGGG + Intergenic
1133568343 16:7016772-7016794 CTGTGAGCAGGGTAGGTGACAGG + Intronic
1136393880 16:29982549-29982571 CTGTCTGGGGAGTAGGTACTGGG + Intronic
1136395022 16:29987856-29987878 CTGGCTGCGTGGTAGTAGCCGGG - Exonic
1137963560 16:52909421-52909443 CTGTCTCCGAAGTAGGTGCTGGG - Intergenic
1138615353 16:58161049-58161071 CTGTAGGCAGGGTAGGTGGCTGG - Intronic
1138619798 16:58201702-58201724 GACTCTGCGGGGGAGGTGCCAGG + Intergenic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1141162452 16:81638453-81638475 CTCTCTGAGGGGATGGTGCCTGG + Intronic
1142630146 17:1220351-1220373 CTGTCTGAGGGGAGGCTGCCTGG - Intronic
1143178077 17:4967959-4967981 CTGTCTGCGGGGGCGGGGCGGGG - Intergenic
1143513713 17:7408896-7408918 CTGTCTGCAGAGTGTGTGCCTGG - Intronic
1145950431 17:28812668-28812690 CTGGCTTTGGGGTAGGGGCCGGG - Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1148093059 17:45034175-45034197 CTTCCTCCGGGGTAAGTGCCAGG - Exonic
1149856691 17:60088876-60088898 CAGTCTGGGAGCTAGGTGCCAGG + Intergenic
1151495028 17:74453948-74453970 CTGTCTGCGGGTGGGGTTCCGGG - Intergenic
1151931584 17:77235436-77235458 CTGTCTGCGGCACAGCTGCCTGG + Intergenic
1152636653 17:81432939-81432961 CTCCCTGTGGGGTTGGTGCCTGG + Intronic
1152784213 17:82239635-82239657 GGGGCTGCGGGGCAGGTGCCTGG + Exonic
1157738717 18:50073484-50073506 CTGTTTGCTGGGTAGCTCCCTGG + Intronic
1159154402 18:64564465-64564487 TTGTCAGCTGGGTAGGTACCTGG + Intergenic
1164650549 19:29887971-29887993 TTGTCTGTGGGGCAGGAGCCAGG - Intergenic
1166106996 19:40602426-40602448 GGGTCTGCGGGGTAGGGGGCAGG - Intronic
1167080747 19:47274841-47274863 CGGTCTGCGGGGTGGGGGCGGGG + Exonic
1168543363 19:57231017-57231039 CTCTCTGAGCGGTTGGTGCCGGG + Intronic
925130204 2:1489031-1489053 GTGTGTGCTGGGTATGTGCCGGG - Intronic
925363770 2:3297005-3297027 CTGCCTGCCGGATGGGTGCCGGG - Intronic
925878914 2:8334170-8334192 CTGTCAGCGGGTTGGGTGCGGGG + Intergenic
926182378 2:10656644-10656666 CTGTCTGCAGCGTGTGTGCCTGG + Intronic
927648787 2:24898364-24898386 CTGTCTGCGGGATGGGAGTCGGG + Intronic
928086298 2:28348325-28348347 CTGTCTAGTGGGTGGGTGCCAGG - Intergenic
928907237 2:36381107-36381129 CTGTGTGGGGGGTAGGGGCGGGG - Intronic
929508423 2:42547094-42547116 CTGTCTCTGGGGGAGGGGCCAGG - Intronic
932280978 2:70491629-70491651 CTGTCTCCGGGGAAGGGGCATGG - Intronic
932702414 2:74000966-74000988 CTGTATGGGGGGTAGGTGTGAGG + Intronic
935361802 2:102251540-102251562 CTGTCTTAAGGGAAGGTGCCTGG - Intergenic
948517311 2:238511786-238511808 CTGTCTGGGTGTTGGGTGCCAGG + Intergenic
948755252 2:240155693-240155715 CTGCCTGTGGGGTAAGTGGCTGG - Intergenic
1171034188 20:21703224-21703246 CTGGCTGCGGGAAAGGGGCCAGG + Intergenic
1171175817 20:23050222-23050244 CTGTCCGCGGCCAAGGTGCCTGG + Intergenic
1171227251 20:23451967-23451989 CTGTCTGCGGTTTCTGTGCCTGG + Intronic
1176120747 20:63453519-63453541 CTCTCAGCGGGGTAGGAGCAGGG + Intronic
1179979611 21:44889208-44889230 CCGGCTGCTGGGTAGGTGGCCGG + Intronic
1180087787 21:45515834-45515856 CTGCCTGCGGGGCCGGGGCCTGG + Exonic
1183921899 22:41176518-41176540 CTGTCTGTGAGGTAGGCACCGGG + Exonic
1184581089 22:45418272-45418294 CAGTCTGCGGGGAAGGTGAATGG + Intronic
1185129316 22:49028630-49028652 CTGTCTGGGGGGCAGGCACCTGG + Intergenic
1185223835 22:49642173-49642195 CTATCTGGGGGGAAGGTGCCAGG - Intronic
950007475 3:9700720-9700742 CTGTCTGCTGGGTTGAAGCCAGG - Intronic
950545712 3:13636891-13636913 GTGTCTGAGGGCTAGGAGCCTGG + Intronic
951962929 3:28348998-28349020 CTGTCCGCGGGCTCGGCGCCAGG + Exonic
952128834 3:30335876-30335898 CTTTCTGGAGGGTAGGTGCAGGG - Intergenic
952531278 3:34264448-34264470 CTGTCTACGGGGTAATTGCAAGG - Intergenic
954268602 3:49489838-49489860 CTGTCTGGGGGATTAGTGCCTGG + Intronic
959320855 3:104873374-104873396 CTTTTTGCGGGGTGGGTGACTGG + Intergenic
959598009 3:108148597-108148619 CTGTCGGAGGGTTGGGTGCCAGG + Intergenic
963123285 3:141794027-141794049 CTTTCTGCCTGGTAGGGGCCTGG - Intronic
966696551 3:182794691-182794713 CTTTCTGCGCTGTAGCTGCCAGG - Intronic
968731164 4:2270018-2270040 CTGCCTGCGGTGTCAGTGCCTGG + Exonic
969512968 4:7630080-7630102 CTGCCTGCAGGGTAGGGCCCAGG - Intronic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
981875344 4:149536349-149536371 GTGTCTGTGGGGTGGGTACCTGG - Intergenic
1001717004 5:173824501-173824523 GGCTCTGCGGGGTAGCTGCCTGG + Intergenic
1004886278 6:20054197-20054219 CTGTCTGCTGGGTAGGTGCGAGG - Intergenic
1005866829 6:29943246-29943268 CTGACCGCGGGGTCGGGGCCAGG + Exonic
1006446959 6:34084973-34084995 CTGTGTGCAGGGCAGGTGCTAGG + Intronic
1008058153 6:46966905-46966927 CTCTCTGCGTGGTAGGTGCCGGG - Intergenic
1013273673 6:108562887-108562909 CTGTCTTGGGGGAAGGGGCCAGG - Intronic
1015718226 6:136213809-136213831 GTGTCTGCGGGGTTGGGGCATGG - Intergenic
1017270966 6:152504891-152504913 GTGTATGAGGGGTAGGTGACAGG - Intronic
1018014373 6:159698926-159698948 CTGTCTGGGGGGTGGGGGGCGGG + Intronic
1025992764 7:66508046-66508068 TTCTCTGCGGGGTACGTGTCTGG - Intergenic
1027173290 7:75888005-75888027 CTCTGTGTGGGGTAGGAGCCAGG - Exonic
1031866416 7:127042247-127042269 CTGTCTGCAGGGTAAGTAACAGG + Intronic
1035601320 8:898543-898565 CTGTGTGCAGGGAAGGGGCCTGG + Intergenic
1041213569 8:55577431-55577453 CTGTTTGGGGGGTGGGGGCCTGG + Intergenic
1042666748 8:71215585-71215607 CTCTCTGCGGGGTCTTTGCCAGG - Intronic
1045875969 8:106981013-106981035 CAGTCTGCAGGGTAGATGGCTGG - Intergenic
1048293029 8:133194743-133194765 GTGTTTGTGGGGTATGTGCCTGG + Intronic
1049100472 8:140575237-140575259 CTGGCTGCCAGGGAGGTGCCAGG - Intronic
1049100481 8:140575272-140575294 CTGGCTGCCAGGGAGGTGCCAGG - Intronic
1049100490 8:140575307-140575329 CTGGCTGCCAGGGAGGTGCCAGG - Intronic
1049427378 8:142543503-142543525 CTGGCTGCCGGGGAGCTGCCTGG - Intronic
1049854947 8:144855659-144855681 CTTTCTGGGGGGCAGGTGCAGGG + Intergenic
1052492653 9:29188838-29188860 CTGTCTGGGAGGAAGGTGGCGGG - Intergenic
1059700407 9:116770395-116770417 CTGAGTGCGGGTTATGTGCCAGG + Intronic
1061370385 9:130194368-130194390 CTGGCTGTGGGGTACGAGCCTGG + Intronic
1198873222 X:141197312-141197334 CTGTCTCAGGGATAGGTTCCCGG - Intergenic
1199086669 X:143635861-143635883 CTGTCTGCGCGTAAGGGGCCAGG + Intergenic
1201601268 Y:15730801-15730823 CTGGGTGGGGGGTAGGTGGCAGG + Intergenic