ID: 903008327

View in Genome Browser
Species Human (GRCh38)
Location 1:20312959-20312981
Sequence TGTTGGGGATCGAACATGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903008327_903008338 12 Left 903008327 1:20312959-20312981 CCTCCCATGTTCGATCCCCAACA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 903008338 1:20312994-20313016 GAGACCAGAAGGGCTGCCGCGGG 0: 1
1: 0
2: 2
3: 12
4: 149
903008327_903008336 2 Left 903008327 1:20312959-20312981 CCTCCCATGTTCGATCCCCAACA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 903008336 1:20312984-20313006 CACAGGTAAGGAGACCAGAAGGG 0: 1
1: 0
2: 0
3: 26
4: 336
903008327_903008342 24 Left 903008327 1:20312959-20312981 CCTCCCATGTTCGATCCCCAACA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 903008342 1:20313006-20313028 GCTGCCGCGGGACCTGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 144
903008327_903008337 11 Left 903008327 1:20312959-20312981 CCTCCCATGTTCGATCCCCAACA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 903008337 1:20312993-20313015 GGAGACCAGAAGGGCTGCCGCGG 0: 1
1: 0
2: 2
3: 17
4: 275
903008327_903008340 18 Left 903008327 1:20312959-20312981 CCTCCCATGTTCGATCCCCAACA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 903008340 1:20313000-20313022 AGAAGGGCTGCCGCGGGACCTGG 0: 1
1: 0
2: 1
3: 12
4: 171
903008327_903008341 19 Left 903008327 1:20312959-20312981 CCTCCCATGTTCGATCCCCAACA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 903008341 1:20313001-20313023 GAAGGGCTGCCGCGGGACCTGGG 0: 1
1: 0
2: 1
3: 18
4: 180
903008327_903008335 1 Left 903008327 1:20312959-20312981 CCTCCCATGTTCGATCCCCAACA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 903008335 1:20312983-20313005 TCACAGGTAAGGAGACCAGAAGG 0: 1
1: 0
2: 1
3: 31
4: 276
903008327_903008331 -10 Left 903008327 1:20312959-20312981 CCTCCCATGTTCGATCCCCAACA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 903008331 1:20312972-20312994 ATCCCCAACAGTCACAGGTAAGG 0: 1
1: 0
2: 0
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903008327 Original CRISPR TGTTGGGGATCGAACATGGG AGG (reversed) Exonic
901943872 1:12685107-12685129 TGTTGGGGATGGGACCTGGTGGG - Intergenic
903008327 1:20312959-20312981 TGTTGGGGATCGAACATGGGAGG - Exonic
907529944 1:55084925-55084947 TGTTTGGGTTGGTACATGGGAGG + Intronic
912892451 1:113549023-113549045 TGTTGGGGAGGAAACATTGGGGG + Intronic
915844697 1:159251663-159251685 TGTTGAGGGGCGAACATGAGTGG - Intergenic
917289842 1:173460917-173460939 TGTTGGCCACAGAACATGGGCGG - Intergenic
924089210 1:240485567-240485589 TGTGGGGGCTGGAGCATGGGGGG - Intergenic
1063636428 10:7787575-7787597 TGGTGGGGATCGGACTGGGGAGG + Intronic
1064989888 10:21246925-21246947 TGTTGGGGGAGGAACATGGTAGG + Intergenic
1073076914 10:100829991-100830013 TTTTGGGGATCGACCAATGGAGG - Intergenic
1077827862 11:5830511-5830533 TGTTGGGGATGGGGCATGGTGGG - Intronic
1082798313 11:57394772-57394794 TGTTGGGGGTTGGGCATGGGAGG - Intronic
1083434157 11:62631222-62631244 TCTTGGGGTTGGAAAATGGGAGG - Intronic
1084026086 11:66450675-66450697 TGTTGGGGATGGAGCCTGGTGGG - Intronic
1085198244 11:74684969-74684991 TGTTTGGGATTGAACAGGGGTGG - Intergenic
1087697687 11:101398935-101398957 TGTTGGGGATCAAACAAGCTTGG + Intergenic
1096807304 12:54148651-54148673 TGTTGGGGAGGGAGAATGGGGGG - Intergenic
1105342971 13:19545339-19545361 TGTGGGAGATGGGACATGGGAGG - Intergenic
1111147105 13:84196603-84196625 TGCTGATGATCGAACATGGAAGG - Intergenic
1116625932 14:47263317-47263339 TTTTGGGGATGGAGGATGGGTGG - Intronic
1120460757 14:84792360-84792382 AGTTGGGGAGTGAGCATGGGAGG - Intergenic
1122239445 14:100352545-100352567 TGATGGTGAGCTAACATGGGAGG + Intronic
1138114671 16:54350930-54350952 TGTTGGAGATGGAACCTGGTGGG - Intergenic
1144466813 17:15503814-15503836 TGTTTGGGATAGAACTTCGGTGG - Intronic
1144563828 17:16343772-16343794 TGGTGGGGAGCGGACAGGGGAGG - Intronic
1144711896 17:17406677-17406699 TGGGGGGGATGGAAGATGGGGGG - Intergenic
1146704184 17:34988312-34988334 TGTTGGGGATGGAATTTGGGAGG + Intronic
1152252233 17:79218220-79218242 TGGTGGGGTTCGGACTTGGGGGG + Intronic
1153283765 18:3438560-3438582 TGATGGGAATGGAAGATGGGGGG - Intronic
1156363147 18:36401770-36401792 TGTGAGGGATAGAACATGAGGGG - Intronic
926631900 2:15144153-15144175 TGTTGGGGAGGGACCGTGGGTGG - Intergenic
929371263 2:41226357-41226379 TGTTGGGGATGGGAGATGTGGGG + Intergenic
931139240 2:59438701-59438723 AGTTGGGGAATGAGCATGGGTGG + Intergenic
931665678 2:64608423-64608445 TGCTGGGGATAGAACACGGGTGG + Intergenic
935712870 2:105914513-105914535 TATGGGGGATCACACATGGGAGG - Intergenic
937334512 2:121053774-121053796 TGTTGGAGATGGAACCTGGTGGG + Intergenic
1177445506 21:21190390-21190412 AGTTGGGCATTGAAGATGGGTGG - Intronic
1178021242 21:28410982-28411004 TGGTGGGGATAGAACATGCAGGG - Intergenic
1178511311 21:33207210-33207232 TGTTAGGCATCGGCCATGGGAGG - Intergenic
1179662271 21:42884306-42884328 TGTGGTGGATTGAACCTGGGAGG + Intronic
1181475813 22:23167217-23167239 TTTTGGGGTTCGACCCTGGGTGG - Intergenic
1182271987 22:29159779-29159801 TGTTGAGGATGGCAGATGGGTGG + Intronic
951555653 3:23917767-23917789 TGTTGGGGAACTAAGATGGACGG + Intronic
953154839 3:40360319-40360341 TGTTGGGGATGGAAGAGGGAGGG + Intergenic
954772006 3:52979484-52979506 TGTAGGGGATCACACATGGGAGG + Intronic
959898049 3:111627472-111627494 TGTTGGCCATAGAACATGGGTGG - Intronic
960260081 3:115557429-115557451 TGTTGAGGATCAAACATAGTGGG + Intergenic
961061240 3:123831080-123831102 TGTTGGGGATGGAACACAGGTGG - Intronic
964866327 3:161265889-161265911 TGTTGGGGAAGGGACATGGAGGG + Intergenic
970276192 4:14403791-14403813 TGTTGGGGAAGGAACCTGGTGGG - Intergenic
974575719 4:63718573-63718595 TGTTTGGAATCAAACATGGCTGG - Intergenic
974855130 4:67452309-67452331 TGTTGGGGAACGGACGTGGTGGG + Intergenic
975462656 4:74672513-74672535 TGTTGGGGAACAATCATAGGTGG - Intergenic
979810101 4:125026438-125026460 TGTTGGGGAGGGGGCATGGGAGG - Intergenic
986511331 5:8509410-8509432 TGATGAGGATCGAGCATGGATGG + Intergenic
987462600 5:18231111-18231133 TGTGGGGTATGGAACATGGTAGG - Intergenic
991987322 5:72302430-72302452 TGTTTGGGAGCAACCATGGGAGG + Intronic
997868032 5:137482077-137482099 TGTCGGGGATAGAAATTGGGAGG + Intronic
1008021362 6:46581643-46581665 TGTTGTGGGTGGAGCATGGGAGG + Intronic
1010610881 6:77952717-77952739 TGTTGGGGCAGGAACATGGTGGG + Intergenic
1012869434 6:104656520-104656542 TGGTGGCCATAGAACATGGGTGG - Intergenic
1021521003 7:21538806-21538828 TGTCGGCTATAGAACATGGGTGG + Intergenic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1026739394 7:72969383-72969405 TGATGGGGCACGGACATGGGGGG - Exonic
1026869371 7:73841296-73841318 TGTTGGGGATCAAGCCTGGCTGG + Intronic
1027104337 7:75395690-75395712 TGATGGGGCACGGACATGGGGGG + Exonic
1041007302 8:53507987-53508009 TGTTGGGGGTAGGAGATGGGTGG - Intergenic
1041670843 8:60490288-60490310 TGTTGGGGAGGGAACCTGGTGGG - Intergenic
1043481961 8:80663134-80663156 TGTTGGGAGGCCAACATGGGAGG + Intronic
1052188160 9:25624059-25624081 TTTTGGGAATCCAACGTGGGTGG - Intergenic
1055615502 9:78067864-78067886 TGTTGGGGGAGGAACATGGTGGG - Intergenic
1060235965 9:121862868-121862890 TGTTAGGGACCGGACAGGGGAGG + Intronic
1185565844 X:1094719-1094741 TGTTGGGGATGGATTCTGGGAGG - Intergenic
1193964551 X:87969197-87969219 TCTTGGGCATTGAACATGGAGGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic