ID: 903008529

View in Genome Browser
Species Human (GRCh38)
Location 1:20314407-20314429
Sequence TCCCCAGGTTGGCCACGAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903008529_903008539 25 Left 903008529 1:20314407-20314429 CCTGTTCGTGGCCAACCTGGGGA 0: 1
1: 0
2: 1
3: 14
4: 112
Right 903008539 1:20314455-20314477 CATCTTCATCAGCACCTCCTCGG 0: 1
1: 0
2: 5
3: 51
4: 378
903008529_903008532 -8 Left 903008529 1:20314407-20314429 CCTGTTCGTGGCCAACCTGGGGA 0: 1
1: 0
2: 1
3: 14
4: 112
Right 903008532 1:20314422-20314444 CCTGGGGACCATTGCCCCCATGG 0: 1
1: 0
2: 1
3: 17
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903008529 Original CRISPR TCCCCAGGTTGGCCACGAAC AGG (reversed) Exonic
900623817 1:3599149-3599171 TCCCCAGGCTGGCCCCGCAGTGG - Intronic
903008529 1:20314407-20314429 TCCCCAGGTTGGCCACGAACAGG - Exonic
904848376 1:33438177-33438199 TTCCCAGGTAGGCCATAAACTGG - Intergenic
904998879 1:34652639-34652661 TCCCCAGGTTGTCCACCAAAGGG + Intergenic
905068558 1:35205497-35205519 TGCCCAGGTTGGTCTTGAACTGG - Intergenic
906747370 1:48231459-48231481 TCCCCAGTGTGGCCATGCACAGG + Intronic
907389295 1:54146867-54146889 TGCCCAGGCTGGTCTCGAACTGG - Intronic
908749200 1:67403442-67403464 TGCCCAGGCTGGTCTCGAACTGG - Intergenic
910984133 1:92989102-92989124 TGCCCAGGCTGGCCTCGAACTGG + Intergenic
910990337 1:93049408-93049430 TCCCAAGGCTGGCCCTGAACTGG + Intergenic
912536970 1:110381528-110381550 TGCCCAGGCTGGTCTCGAACTGG + Intronic
916086889 1:161277044-161277066 TGCCCAGGTTGGTCTCAAACTGG - Intronic
917064195 1:171073933-171073955 TTCCCAGGTTGGTCTTGAACTGG - Intergenic
918243237 1:182638157-182638179 TGCCCAGGCTGGCCTTGAACTGG - Intergenic
1064714791 10:18165607-18165629 TCACCATGTTGGCCAGGTACAGG + Intronic
1069494328 10:68889367-68889389 TGCCCAGGCTGGCCTTGAACTGG + Intronic
1069713400 10:70505402-70505424 TCTCCATGTTGGTCTCGAACAGG - Intronic
1070305179 10:75235300-75235322 GCGCCAGGTTGGCCAAGAGCTGG + Exonic
1070824354 10:79382093-79382115 TCCCCAGGTTGGCCCCAGACTGG - Intergenic
1077020639 11:415794-415816 TCCCCAGGTTGACCTGGGACTGG + Intronic
1078213635 11:9292622-9292644 TGCCCAGGCTGGTCTCGAACTGG - Intronic
1078717869 11:13856982-13857004 TCCCCAGGAACGCCACGCACGGG + Intergenic
1083240828 11:61387134-61387156 TGCCCAGGCTGGTCTCGAACTGG - Intergenic
1083301956 11:61744246-61744268 GCACCAGGTTGGGCTCGAACTGG - Exonic
1083466467 11:62850007-62850029 TGCCCAAGTTGGTCTCGAACTGG - Intergenic
1087191439 11:95258554-95258576 TGCCCAGGTTAGTCTCGAACTGG + Intergenic
1090143245 11:124289112-124289134 TCCCCAGGATGGTCTCAAACTGG + Intergenic
1092081120 12:5717245-5717267 TCCCCAGCTTGTCCTCCAACTGG - Intronic
1094633729 12:32203530-32203552 TCTCCGGGTTGGCCACTACCAGG - Intronic
1102096752 12:110247221-110247243 TCCCCAGGTTAGGTACAAACAGG - Intergenic
1102236749 12:111298556-111298578 TCTCCAGGTTGGTCATGATCAGG - Exonic
1102877830 12:116461521-116461543 TCCTGAGGTTGGCCATGGACTGG - Intergenic
1103685628 12:122730043-122730065 TCTTCACGTTGGCCATGAACAGG - Exonic
1105323664 13:19350893-19350915 TGCCCAGGGTGGCCTCAAACGGG - Intergenic
1108397066 13:49999585-49999607 TCCCCAGGCTGGTCTTGAACTGG + Intronic
1111614054 13:90641682-90641704 TGCCCAGGCTGGTCACGAAGTGG + Intergenic
1112355682 13:98673207-98673229 TCCCCAGATTGGCCACAAGATGG - Intergenic
1114192022 14:20446899-20446921 TTCCCAGGCTGGTCTCGAACTGG - Exonic
1114301802 14:21385266-21385288 TCCACAGTTCGGCCAGGAACAGG + Exonic
1114496046 14:23132983-23133005 TGCCCAGGCTGGTCTCGAACTGG + Intronic
1117354672 14:54912459-54912481 TCCCCAGCCTGGCCACAAAAAGG - Intergenic
1119813873 14:77547656-77547678 GGCCCAGGTTGGAAACGAACAGG - Intronic
1122930809 14:104932384-104932406 GCCCCAGGGTGGCCAGGCACGGG + Intronic
1124139822 15:27067480-27067502 TCCCCAGGGTGGCCGACAACCGG + Intronic
1126790758 15:52219007-52219029 TCCCCAGGCTGGTCACAAAGGGG - Intronic
1128131855 15:65233527-65233549 TGGCCAGGTTGGTCTCGAACTGG - Intergenic
1128792637 15:70444399-70444421 ATCCCAGTTTGGCCACTAACTGG + Intergenic
1129192323 15:73944693-73944715 GGCCCAGCTTGGCCACAAACTGG - Intronic
1130635657 15:85617440-85617462 TCGCCATGTTGGCCACGATCTGG + Intronic
1132809322 16:1789998-1790020 TCCCCGGCTTGGCCACGCCCAGG - Intronic
1133780285 16:8933657-8933679 TGCCCAGGTTGGTCTTGAACTGG + Intronic
1135032007 16:19045935-19045957 TGCCCAGGCTGGTCTCGAACTGG + Intronic
1135276598 16:21118646-21118668 TGCCCAGGTTGGTCTTGAACTGG + Intronic
1135514140 16:23115446-23115468 TGCCCAGGTTGGTCTTGAACTGG - Intronic
1138151428 16:54661172-54661194 TGCCCAGGCTGGCCTTGAACTGG + Intergenic
1139402139 16:66691252-66691274 TGCCCAGGTTGGTCGCAAACTGG - Intronic
1139497069 16:67327294-67327316 TCACCATGTTGGCCACGCTCAGG - Intronic
1140891642 16:79290052-79290074 TCACCATGTTGGCCAGGCACTGG + Intergenic
1140922994 16:79556375-79556397 TCCACAGGTTTGCCATGATCTGG + Intergenic
1144555417 17:16278251-16278273 TCGCCATGTTGGCCAGGCACAGG + Intronic
1144738984 17:17570712-17570734 TCCCCAGGTTTTCCAGGAAATGG - Intronic
1147581613 17:41630475-41630497 TCTCCAGGTTGGCCCCGGCCAGG + Intergenic
1149784372 17:59422907-59422929 ACCCCAGGTTGGCCTAGAACTGG + Intergenic
1151370338 17:73643495-73643517 TGCCCGGCTTGGCCACGTACGGG - Intronic
1151809144 17:76426208-76426230 TTCCCAGGCTGGTCTCGAACGGG + Intronic
1155313991 18:24552881-24552903 TCCCCAGGCTGGTCTCGAATGGG - Intergenic
1157374149 18:47148195-47148217 TGCCCAGGATGGTCTCGAACTGG + Intronic
1157438602 18:47692375-47692397 TCCCCAGGTTGGCTGGGAAAGGG - Intergenic
1158898246 18:61935940-61935962 TGCCCAGGCTGGCCTTGAACTGG - Intergenic
1162389825 19:10382789-10382811 TGCCCAGGTTGGTCTTGAACTGG - Intergenic
1165104559 19:33461408-33461430 TCCCCAGGTTGGGCAGGGTCGGG + Intronic
1167033939 19:46982055-46982077 TGCCCAGGTTGGTCTCGAACTGG + Intronic
1167098339 19:47387991-47388013 TGCCCAGGCTGGTCTCGAACTGG + Intergenic
1167593085 19:50414937-50414959 TGACCAGGTTGGCCACGAGGGGG - Exonic
925600741 2:5606532-5606554 TTCCCAGGTTGGCCTCGGTCTGG + Intergenic
926656815 2:15416606-15416628 TCACCATGTTGGCCAGGCACTGG - Intronic
927665406 2:25028568-25028590 TGCCCAGGCTGGTCTCGAACTGG + Intergenic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
937913043 2:127085505-127085527 TGCCCAGGAGGGCCATGAACAGG - Intronic
941156853 2:161989456-161989478 TACCCAGGCTGGTCTCGAACTGG + Intergenic
942011562 2:171767832-171767854 TGCCCAGGCTGGTCTCGAACTGG + Intergenic
942903161 2:181146882-181146904 TCCCCATCATGGCCACAAACAGG + Intergenic
948036618 2:234863287-234863309 TCCCCACGTAGGCCACGAAGTGG - Intergenic
1176172560 20:63702541-63702563 TGCCCAGGTTGGCCGTGAAGTGG - Intronic
1179909395 21:44439927-44439949 TGCCCAGGCTGGTCATGAACTGG + Intronic
1183894259 22:40955306-40955328 TGCCCAGGCTGGTCTCGAACTGG + Intronic
1184161611 22:42700551-42700573 ACCCCAGCCTGGCCACGCACAGG - Intronic
1184748981 22:46473396-46473418 GCCCCAGGTGGGTCACAAACTGG - Intronic
953438416 3:42897852-42897874 TCCCCAGGTTGGCCCCCAACTGG + Intronic
955333823 3:58068938-58068960 TGCCCAGGCTGGTCACAAACTGG - Intronic
955797316 3:62650984-62651006 TCTCCAAGTTGGCCATGAGCAGG + Exonic
956743488 3:72293192-72293214 TGCCCAGGCTGGTCTCGAACTGG + Intergenic
961266284 3:125645556-125645578 TGCCCAGGCTGGCCTCGAACGGG - Intergenic
963885388 3:150576229-150576251 TGCCCAGGCTGGTCTCGAACTGG - Intronic
968129351 3:196183704-196183726 ACCACAGGTTGGCCTGGAACTGG - Intergenic
977303527 4:95295876-95295898 TGCCCAGGCTGGTCTCGAACTGG - Intronic
978851499 4:113342492-113342514 TGGCCAGGTTGGTCTCGAACTGG - Intronic
983959110 4:173730862-173730884 TGCCCAGGTTGGTCTCGAACAGG - Intergenic
984427696 4:179608863-179608885 TCACCAGGCTGGTCTCGAACTGG - Intergenic
985542041 5:491859-491881 TCCCCAGGTTGCCGAAGAAGAGG + Exonic
991072395 5:62498670-62498692 TCCCCATGTTGGCCAGGCTCAGG - Intronic
992714948 5:79501175-79501197 TGCCCAGGCTGGTCTCGAACTGG + Intronic
997226268 5:132211600-132211622 TCCCTAGGTAGGCCAGGGACTGG + Intronic
998091478 5:139373373-139373395 TCACCATGTTGGCCAGGCACTGG + Intronic
998965115 5:147530911-147530933 TACGCAGGCTGGCCACGAACTGG - Intergenic
1002050054 5:176565516-176565538 TCCCCAGCTTAGCCAAGCACAGG - Intronic
1003233110 6:4272521-4272543 TGCCCAGGCTGGCCTTGAACTGG + Intergenic
1004050241 6:12070490-12070512 GCACCATGTTGGCCACGCACTGG - Intronic
1006028385 6:31161815-31161837 TCCCCAGGTGGGGCGGGAACAGG - Exonic
1007539826 6:42631011-42631033 TGCCCAGGCTGGTCTCGAACTGG + Intronic
1007903975 6:45440263-45440285 TGCCCAGGATGGCCAAGAACAGG - Intronic
1009890378 6:69673549-69673571 CCCCCAGGTTGCCCACACACAGG - Intergenic
1010510591 6:76713768-76713790 TCACCATGTTGGCCATGAATAGG + Intergenic
1014138964 6:117919103-117919125 TCCCCAGGCTGGTCTTGAACTGG + Intronic
1020120488 7:5500561-5500583 TGCCCAGGTTGGCCAGCGACAGG + Exonic
1020560933 7:9728106-9728128 TGCCCAGGTTTTCCAGGAACTGG + Intergenic
1025606960 7:63046371-63046393 TGCCCAGGCTGCCCACGACCTGG - Intergenic
1026404767 7:70053749-70053771 TGCCCAGGCTGGTCTCGAACTGG + Intronic
1027177532 7:75914428-75914450 TGCCCAGGTTGGTCTCGAACTGG - Intronic
1037301552 8:17456841-17456863 TTCCCAGGCTGGCCTCAAACTGG + Intergenic
1037783432 8:21886952-21886974 TTCCCAGGTTTGCCATGGACTGG - Intergenic
1039947652 8:42143789-42143811 TGCCCAGGCTGGTCTCGAACTGG - Intergenic
1046792279 8:118334801-118334823 TGCCCAGGTTGGTCTCGAACTGG + Intronic
1052019056 9:23504932-23504954 TCACCATGTTGGCCACGGCCAGG + Intergenic
1053202789 9:36164110-36164132 TCACCAGGCTGGCCATGGACTGG + Intergenic
1060965694 9:127711276-127711298 TCCACAAGGTGACCACGAACCGG + Exonic
1189440542 X:41031861-41031883 TGCCCAGGCTGGTCACGAACGGG - Intergenic
1189717610 X:43882128-43882150 TCCCCAGACTGTCCACGCACGGG - Intronic