ID: 903008955

View in Genome Browser
Species Human (GRCh38)
Location 1:20317220-20317242
Sequence CAGTGTCCCCACATGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 920
Summary {0: 1, 1: 1, 2: 7, 3: 114, 4: 797}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903008953_903008955 -10 Left 903008953 1:20317207-20317229 CCACACTGAGCTTCAGTGTCCCC 0: 1
1: 3
2: 51
3: 488
4: 2428
Right 903008955 1:20317220-20317242 CAGTGTCCCCACATGGAAAGTGG 0: 1
1: 1
2: 7
3: 114
4: 797
903008951_903008955 2 Left 903008951 1:20317195-20317217 CCAGTTACCTCACCACACTGAGC 0: 1
1: 0
2: 1
3: 19
4: 200
Right 903008955 1:20317220-20317242 CAGTGTCCCCACATGGAAAGTGG 0: 1
1: 1
2: 7
3: 114
4: 797
903008952_903008955 -5 Left 903008952 1:20317202-20317224 CCTCACCACACTGAGCTTCAGTG 0: 1
1: 0
2: 3
3: 30
4: 381
Right 903008955 1:20317220-20317242 CAGTGTCCCCACATGGAAAGTGG 0: 1
1: 1
2: 7
3: 114
4: 797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903008955 Original CRISPR CAGTGTCCCCACATGGAAAG TGG Intronic
901148963 1:7087682-7087704 CAGTTTCCACACCTGTAAAGTGG + Intronic
901234374 1:7659895-7659917 CAGTTTCCTCACTTGTAAAGTGG - Intronic
901269037 1:7936125-7936147 CACTGTGCCCAGCTGGAAAGTGG - Intronic
901504380 1:9675442-9675464 CAGTTTCCCCATCTGTAAAGTGG - Intronic
902193679 1:14782002-14782024 CAGTGTCCTCATCTGTAAAGTGG + Intronic
902803362 1:18845322-18845344 CAGTGTCCCCACCTTGCAGGGGG - Intronic
902805205 1:18857039-18857061 CAGTTTCCTCACCTGTAAAGTGG - Intronic
902812001 1:18893249-18893271 CAGTTTCCTCACCTGGAAAATGG + Intronic
902838989 1:19063566-19063588 CAGTTTCCTCACCTGGAGAGTGG + Intergenic
903008955 1:20317220-20317242 CAGTGTCCCCACATGGAAAGTGG + Intronic
903024547 1:20418063-20418085 CATTGTGTCCTCATGGAAAGGGG + Intergenic
903193598 1:21669513-21669535 CAGTTTCCCCACCTGTAAAATGG - Intergenic
903361123 1:22777950-22777972 CAGTTTCCTCACCTGGAAAATGG - Intronic
903374675 1:22858481-22858503 CAGTCTCCTCATCTGGAAAGGGG - Intronic
903471719 1:23592006-23592028 CGGTTTCCCCATCTGGAAAGGGG + Intronic
903664074 1:24996049-24996071 CAGTGTCTCCATCTGCAAAGGGG + Intergenic
903670050 1:25030121-25030143 CAGTTTCCCCATCTGCAAAGTGG + Intergenic
903779339 1:25811346-25811368 CAGTGTCCTCATCTGGAAAGTGG + Intronic
904046910 1:27614672-27614694 CAGTCTCCCCCTCTGGAAAGTGG - Intronic
904116315 1:28164418-28164440 GAGTGTGCCCACTTGGAATGTGG - Intronic
904397292 1:30230374-30230396 CCCTGTCCCCACAGGGAGAGGGG - Intergenic
904936163 1:34131215-34131237 CAGTGTCCTCATCTGTAAAGTGG - Intronic
905037332 1:34926727-34926749 CAGTCTCCCCACCTGTAAAATGG + Intronic
905371705 1:37485960-37485982 CAGTCTCCCCACCTGTAAAAGGG + Intergenic
905434534 1:37947453-37947475 CAGTTTCTCCACCTGGAAAATGG - Intergenic
905853038 1:41288281-41288303 CAGTGTCCTCATCTGGAAATGGG + Intergenic
905858484 1:41330599-41330621 CTGTGTCTCCATATGGAGAGGGG - Intergenic
906024742 1:42664001-42664023 CAGTTTCCTCACATGAAAAATGG + Intronic
906073937 1:43038001-43038023 CAGGCTCCCCACATGTAAAATGG + Intergenic
906127693 1:43437613-43437635 CAGTGACCGGCCATGGAAAGGGG + Exonic
906678880 1:47711562-47711584 CTGTGTCCCCACCTGTAAGGAGG - Intergenic
907162879 1:52384275-52384297 CAGTGTGGCAACATGGAAAAGGG - Intronic
907184852 1:52602007-52602029 CAGTTTCTCCACATGTTAAGTGG - Intergenic
907377441 1:54055252-54055274 CACTGTGCCCAGCTGGAAAGAGG + Intronic
907910104 1:58817910-58817932 CAGTTTCCCCACCTGGAAAAAGG + Intergenic
907955223 1:59221803-59221825 CTGTGTCCTCACATGGCAAAAGG - Intergenic
908417962 1:63931989-63932011 CAGTTTCCCCTCATCCAAAGGGG - Intronic
908794421 1:67816906-67816928 CAGTGTCCCCATCTGTAAAGTGG + Intronic
909239389 1:73192840-73192862 CTGTGTCCTCACATGGAAGAAGG + Intergenic
909484459 1:76157906-76157928 CAGAGTCCTCAAGTGGAAAGTGG - Intronic
910629733 1:89342542-89342564 CATTTTCCTCCCATGGAAAGTGG + Intergenic
910832144 1:91471671-91471693 CTGAGTCCTCACATGGAAAAAGG - Intergenic
910985174 1:92998241-92998263 CAATCTCCCCGCATGGAAAAGGG + Intergenic
912633544 1:111270511-111270533 CAGTTTCCTCGCCTGGAAAGTGG - Intergenic
912949537 1:114111322-114111344 CAGTGTCCCCAGGTAAAAAGTGG - Intronic
912961485 1:114199500-114199522 TTGTGTTCCCACATGGAAAAAGG + Intergenic
913045940 1:115073539-115073561 CACAGTCCCCAAATAGAAAGCGG + Intronic
913053516 1:115137302-115137324 CAGTGTCCTCACCTGTAAATAGG + Intergenic
913279959 1:117176220-117176242 CAGTTTCCCCACATGTAAAAAGG - Intronic
913568641 1:120098571-120098593 CAGTTTCCTCACCTGTAAAGTGG + Intergenic
914289455 1:146259592-146259614 CAGTTTCCTCACCTGTAAAGTGG + Intergenic
914451528 1:147796961-147796983 CAGTTTCCTCCCCTGGAAAGAGG - Intergenic
914550491 1:148710345-148710367 CAGTTTCCTCACCTGTAAAGTGG + Intergenic
915510605 1:156384983-156385005 CAGCGTCTCCACAGGGAGAGGGG + Exonic
916997609 1:170317370-170317392 CAGTTTCCTCATATGTAAAGAGG - Intergenic
917503100 1:175603851-175603873 CAGTCTAGCCACATGGACAGGGG - Intronic
917623494 1:176822052-176822074 CACTCACCCCACATGCAAAGTGG + Intronic
918025490 1:180740886-180740908 CTGTGTCCTCACATGGTAAAAGG + Intronic
918121213 1:181542454-181542476 CACAGTCCCCACATGTCAAGGGG + Intronic
918136497 1:181678766-181678788 TAGTTTCTCCACCTGGAAAGTGG + Intronic
919791647 1:201294599-201294621 CAGCTTCTTCACATGGAAAGTGG + Intronic
919905978 1:202078528-202078550 TAGTTTCCCCATATGGAAAATGG - Intergenic
920185056 1:204154319-204154341 CAGTTTCCCCACCTGTAAAGTGG + Intergenic
920186770 1:204164331-204164353 CAGTGTCCTCATCTGCAAAGTGG + Intronic
920191390 1:204196341-204196363 CAGTGTCCACCCCTGGGAAGGGG - Intronic
920286863 1:204885917-204885939 CAGAGTGCCCATCTGGAAAGGGG - Intronic
921551235 1:216537770-216537792 CAGTTTCCTCAAATGTAAAGTGG - Intronic
922625784 1:227040729-227040751 CAGTTTCCTCCTATGGAAAGAGG + Intronic
923449355 1:234102136-234102158 CTTTTTCTCCACATGGAAAGGGG - Intronic
923802579 1:237224894-237224916 CAGTTTCCTCACCTGTAAAGTGG - Intronic
924127822 1:240874082-240874104 CTGTGTCCCCACATGGTAGAAGG - Intronic
1062970297 10:1643065-1643087 CAGTTTCCCCAGGTGTAAAGTGG - Intronic
1063393354 10:5664473-5664495 CATAGTCCCCACATAGCAAGTGG + Intronic
1063465996 10:6245002-6245024 CAGTTTCCCCACCTGTAAAGTGG - Intergenic
1063989063 10:11539892-11539914 CAGTCTCCACATATGTAAAGTGG - Intronic
1064066028 10:12182180-12182202 CAGTGTCCCCCCAGGGGAAAAGG - Intronic
1064235713 10:13572714-13572736 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1064596349 10:16949058-16949080 CAGTTTCCTCACTTGGAAAAAGG + Intronic
1064606377 10:17045219-17045241 CAATTTCCCCAGAAGGAAAGGGG - Intronic
1064630973 10:17310382-17310404 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1065249489 10:23796281-23796303 CAGTTTCCCCATTTGTAAAGTGG + Intronic
1065420113 10:25533904-25533926 CAGCTTCCCCATATGTAAAGTGG + Intronic
1066929182 10:41735367-41735389 AAGTATCCCCACATAGAAACTGG + Intergenic
1067056794 10:43057208-43057230 CAGTTTCCTCATCTGGAAAGTGG - Intergenic
1067345788 10:45438356-45438378 CAGTTTCCCCCCATGTAAAATGG + Intronic
1068524774 10:58116080-58116102 CTGTGTCCTCACATGGTAAAAGG + Intergenic
1068659958 10:59613519-59613541 TGGTGTCCTCACATGGGAAGGGG + Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069540659 10:69291508-69291530 CAGTTTCCCCATCTGTAAAGTGG - Intronic
1069707024 10:70465331-70465353 CAGTTTCCCCACCTGTAAAATGG - Intergenic
1069869508 10:71524616-71524638 GTGTGACCCCACATGGAAAAGGG + Intronic
1069887981 10:71635907-71635929 CTGTGTCCCCACATGGCTGGAGG + Intronic
1070495510 10:77017820-77017842 CAGTTTCCTCATATGTAAAGTGG + Intronic
1070583575 10:77743480-77743502 CTGTGTCCTCACATGGTAAAGGG - Intergenic
1070605502 10:77895358-77895380 CAGTGACCCCACATCAAAAGGGG + Intronic
1070605578 10:77895954-77895976 CAGTGACCCCACATCAAAAGGGG - Intronic
1071130835 10:82391601-82391623 CTGTGACCACACATGGGAAGGGG - Intronic
1072734341 10:97868975-97868997 CAGTTTCCCCATATGTAAAATGG - Exonic
1073958251 10:108896718-108896740 CAGTGTGGCCACATGAAAAAAGG - Intergenic
1074181737 10:111071242-111071264 CAGTTTCCTCATATGGAAAAAGG - Intergenic
1074229646 10:111521218-111521240 CTGTGTCCTCATTTGGAAAGTGG - Intergenic
1074244987 10:111680717-111680739 CAGTGTCCTCACATGGCAGAAGG - Intergenic
1074447829 10:113534785-113534807 CAGTGTCCCCATCTGTAAAATGG + Intergenic
1075449008 10:122534688-122534710 CAGTTTCTTCATATGGAAAGTGG + Intergenic
1075874333 10:125793970-125793992 CAGTGTCCTCACCTGTAATGAGG + Intronic
1076072471 10:127501724-127501746 CAGTGTGGTCACATGGAAACAGG + Intergenic
1076252536 10:128995679-128995701 CAGTGTTCCCATCTGGAAAATGG + Intergenic
1076720954 10:132392894-132392916 CAGTGTCCTCATCTGTAAAGTGG - Intergenic
1077299551 11:1840713-1840735 CAGTTTCCCCACTTGTCAAGAGG + Intronic
1077316323 11:1920945-1920967 CAGTTTCCCCACTTGGAGAGTGG + Intronic
1077542388 11:3153183-3153205 CAGTGTCCCCACCTGTAAAATGG + Intronic
1078445349 11:11400657-11400679 CTGTGTCCTCACATGGCAAAAGG + Intronic
1078471944 11:11595321-11595343 CTGTGTCCTCACATGGTAAAAGG - Intronic
1078520871 11:12061911-12061933 CAGTTTCCCCATCTGTAAAGTGG - Intergenic
1078595699 11:12684615-12684637 CAGTTTCCCCATCTGGAAAATGG + Intronic
1078646243 11:13143351-13143373 CAGAGTCCCCACCTGGAAAATGG + Intergenic
1078836158 11:15032104-15032126 CAGTGTCCTCACATGGCCAAAGG - Intronic
1078836633 11:15036379-15036401 CAGTGTCCTCACATGGCCAAAGG - Intronic
1078908174 11:15706635-15706657 CAGTGTCCTCACATGGCAGGGGG - Intergenic
1078979030 11:16510846-16510868 CAGTTTACCCACATGGAAAATGG - Intronic
1079003128 11:16774165-16774187 CACTCTCCCCACATGGAAGGAGG - Intergenic
1079098117 11:17524094-17524116 CAGTTTCCTCATATGTAAAGTGG + Intronic
1079158058 11:17967302-17967324 CAGTGTGACCACGTGAAAAGTGG - Intronic
1079329733 11:19523419-19523441 CAGTTTCCCTACCTGGAAAATGG + Intronic
1079454498 11:20624961-20624983 CAGTGTCCACACCTGCAAAGTGG - Intronic
1079610745 11:22429944-22429966 CAGTGTCTCCATATGTAAAATGG + Intergenic
1080394110 11:31874205-31874227 CAGTTTCCTCACCTGGAAAATGG - Intronic
1080687000 11:34524286-34524308 CAGTGTGCCCACCTGCAGAGTGG - Intergenic
1081325268 11:41737005-41737027 CAGTTTCCACACATGGTGAGAGG - Intergenic
1081458431 11:43248202-43248224 CAGTCAGCCCACAGGGAAAGAGG - Intergenic
1081495961 11:43610560-43610582 CAGTTTCCCCATATGCAAAATGG + Intronic
1081614212 11:44580950-44580972 CAGGGACCCCACATGGCAACAGG - Intronic
1081761085 11:45576814-45576836 CCCAGTCCCCTCATGGAAAGTGG + Intergenic
1081936587 11:46908429-46908451 CATTGTCCCCAGCTGTAAAGTGG - Intronic
1082990222 11:59201143-59201165 CTGTGTCCCCACATGGTAGAAGG + Intronic
1083152262 11:60799121-60799143 CAGTGTCTCCATCTGTAAAGTGG + Intronic
1083547222 11:63558083-63558105 CAGTTTCCCCATCTGTAAAGTGG + Intronic
1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG + Intronic
1083966562 11:66047287-66047309 AAGTGTCCCAAGATGGGAAGAGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084389216 11:68864198-68864220 CAGTTTCCACACCTGGGAAGTGG - Intergenic
1084417782 11:69043388-69043410 CAGTTTCCCCATCTGTAAAGTGG - Intergenic
1084483856 11:69436942-69436964 CAGTTTCCCTCCCTGGAAAGTGG - Intergenic
1084497776 11:69515057-69515079 CCGTGGCCCCACATGGAGACAGG + Intergenic
1084543964 11:69804688-69804710 CAGTGTCCCCATCTGTCAAGTGG - Intergenic
1084593171 11:70102264-70102286 CAGTGTTCCCATCTGTAAAGGGG + Intronic
1084660575 11:70544263-70544285 CAGTGTCCTCATCTGGAAAATGG + Intronic
1084696310 11:70757646-70757668 CTGTGTCCCCTCAAGGAGAGAGG + Intronic
1085395074 11:76203084-76203106 CAGTTTCCCCACTTGCACAGTGG - Intronic
1085530182 11:77187822-77187844 CAGTTTCCCCATCAGGAAAGTGG - Intronic
1085600836 11:77854783-77854805 CAGAGTCCCCACTGGGACAGTGG - Intronic
1085699048 11:78729913-78729935 CAGGGTCACCACATGAAAACTGG - Intronic
1085824720 11:79832862-79832884 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1086051828 11:82601270-82601292 CTGTGACCTCACATGGGAAGGGG + Intergenic
1086208330 11:84287002-84287024 CAGTTTCCTCATATGTAAAGTGG + Intronic
1088503450 11:110507095-110507117 CAGTTTCCTCACATGTAAAATGG - Intergenic
1088832780 11:113551642-113551664 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1088846802 11:113675133-113675155 CAGTTTAGCCACATGCAAAGGGG + Intergenic
1090283585 11:125479688-125479710 CTGTGTCCCCACATGGTAGAAGG - Intronic
1090328886 11:125914171-125914193 AAGTGTCACCACATATAAAGAGG - Intronic
1090407909 11:126488380-126488402 CAGTTTCCTCACCTGTAAAGTGG + Intronic
1090623506 11:128584437-128584459 CAGAGTCCCCACCTGGTAAATGG + Intronic
1092182152 12:6453238-6453260 CAGTGTGCCCCCTTGGAAATCGG - Exonic
1092233447 12:6791073-6791095 AAGTGCTCCCACATTGAAAGAGG - Intronic
1093158997 12:15722751-15722773 CAGTGTCCTCACATGGCAGAAGG + Intronic
1093681010 12:22003447-22003469 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1095710888 12:45286834-45286856 CAGTGTCTGCACCTGGAAAATGG - Intronic
1096350188 12:50891771-50891793 CTGTGTCCTCACATGGCAAAAGG + Intergenic
1096518661 12:52172005-52172027 CTGTTTCCCCATCTGGAAAGTGG - Intronic
1096815934 12:54201726-54201748 CAGGGTCACCAGATGGAGAGCGG - Intergenic
1097132056 12:56818963-56818985 CTGAGTCCCCTCATGGAAAGGGG + Intergenic
1098596656 12:72280204-72280226 TAGTGTCCTCATCTGGAAAGTGG + Intronic
1099613308 12:84904165-84904187 TAGAAACCCCACATGGAAAGAGG + Intronic
1099969238 12:89483478-89483500 CTGTGTCCTCACATGGTGAGAGG + Intronic
1100336665 12:93637569-93637591 CAGTGTTCTCACCTGGAAACTGG + Intergenic
1100437360 12:94583805-94583827 GAGTGACCTGACATGGAAAGAGG - Intronic
1100806308 12:98287505-98287527 CTGTGTCCCCACATGGCAGAAGG - Intergenic
1100865478 12:98852646-98852668 CAGTTTCCCCACCTGTAAACAGG - Intronic
1100981629 12:100166852-100166874 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1100994459 12:100288481-100288503 CAGTTTCACCACAAGTAAAGAGG - Intronic
1101229044 12:102721019-102721041 CAGTGTTTCCACATGGAGATAGG - Intergenic
1101750211 12:107577275-107577297 CAGTGTCTTCACCTGTAAAGTGG - Intronic
1101818179 12:108162006-108162028 CAGTGTCCCCATCTGTAAAGTGG - Intronic
1101945012 12:109130036-109130058 CAGTGTCCCCATCTAGAAAAGGG - Intronic
1101953039 12:109191088-109191110 CAGTTTCCTCATATGGAAAATGG - Intronic
1101984569 12:109435720-109435742 CAGTTTCCCTGCATAGAAAGCGG - Intronic
1102010590 12:109616165-109616187 CTGTTTCCCCACATGTAAAGTGG + Intergenic
1102169506 12:110831391-110831413 CAGTTTCCTCACCTGTAAAGGGG + Intergenic
1102189411 12:110975391-110975413 CAGTGTCTCCACCTGGAAAATGG + Intergenic
1102303810 12:111790142-111790164 CAGTTTCCCCATCTGAAAAGTGG + Intronic
1102410499 12:112713981-112714003 CAGTTTCCCCACCTGTAAAATGG + Intronic
1102413100 12:112737327-112737349 CAGTTTCCCCACTTGTAAAATGG + Intronic
1102459320 12:113090514-113090536 CAGTTTCCCCACCTGTAATGGGG - Intronic
1102511782 12:113420986-113421008 CAGTTTCCCTATGTGGAAAGTGG - Intronic
1102549713 12:113682839-113682861 GCGTGTCCCCACATTCAAAGAGG - Intergenic
1102962716 12:117102999-117103021 CAGTTTCCCCATCTGCAAAGTGG + Intergenic
1103220327 12:119239067-119239089 CAGTGTCTCCAGATGTACAGGGG - Intergenic
1103701909 12:122852488-122852510 CAGTGGCCCCACGAGGGAAGTGG + Intronic
1103946086 12:124527343-124527365 CAGTTTCCTCATATGTAAAGAGG + Intronic
1103951740 12:124555119-124555141 CAGTGTCCCCATCTGTAAACAGG + Intronic
1104041609 12:125134529-125134551 CAGTGTCCACACCTGCAATGGGG + Intronic
1104093791 12:125537875-125537897 CAGTGTCCCCACTTGCAACATGG + Intronic
1104603331 12:130168580-130168602 CAGGGTCTTCACATGTAAAGTGG - Intergenic
1104919009 12:132280908-132280930 CAGTTTCCCCATATGTAAAATGG + Intronic
1104954689 12:132458460-132458482 CAGTCTCCTCACCTGTAAAGGGG - Intergenic
1105401211 13:20097654-20097676 CAGTGTCTCCATATGTAAAACGG - Intergenic
1105507219 13:21020670-21020692 CAGTGTCCCTACATGGAGAGAGG - Intronic
1105589382 13:21776850-21776872 CAGTGTTCCCACATGGAAAGGGG - Intergenic
1106690068 13:32105277-32105299 CTGTGTCCTCACATGGAGAAAGG - Intronic
1106716196 13:32390919-32390941 CAGTTTCCCCATCTGTAAAGTGG - Intronic
1108057029 13:46495299-46495321 CTGTGTCCTCACATGGTAAAAGG + Intergenic
1108374185 13:49797973-49797995 CTGTGTCCTCACATGGCAGGAGG - Intergenic
1108374190 13:49798004-49798026 CTGTGTCCTCACATGGCAGGAGG - Intergenic
1110253917 13:73410341-73410363 CAGTCTCTCCACATGTAAAATGG - Intergenic
1110424834 13:75355114-75355136 CAGTGTCCACACTGGGAATGTGG + Intronic
1111853251 13:93603521-93603543 CAGTTTCCTCACCTGCAAAGTGG - Intronic
1111962344 13:94825456-94825478 CAGTTTCCTCACCTGTAAAGGGG - Intergenic
1112102373 13:96203319-96203341 CTGTGTCCTTACATGGCAAGAGG + Intronic
1112207275 13:97337173-97337195 CTGTGTCCGCACATGGCAGGAGG - Intronic
1112751565 13:102588834-102588856 CTGTGTCCTCACAGGGGAAGGGG - Intergenic
1113432987 13:110266312-110266334 CCGTCTCCCCACATGGAGAACGG - Intronic
1113459032 13:110468863-110468885 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1113501010 13:110774311-110774333 CTGTGTCCTCACATGGCATGAGG + Intergenic
1113585628 13:111462308-111462330 CAGTTTTCCCACCTAGAAAGTGG + Intergenic
1114408491 14:22478538-22478560 CAGTTTCCTCACTTGTAAAGTGG - Intergenic
1116837741 14:49787542-49787564 CAGTGTCCTCACGTGGCAAAAGG + Intronic
1116900850 14:50361564-50361586 CTGTGTCCTCACATGGCAAAAGG + Intronic
1117619654 14:57571661-57571683 CAGTTTCCTCATCTGGAAAGTGG + Intronic
1117816788 14:59606953-59606975 CAGTGTTCCCACCTGTAAATAGG + Intronic
1118318496 14:64739734-64739756 CTGTGTCCTCACATGGCAAAGGG + Intronic
1118349051 14:64960551-64960573 CAGTTTCCTCACCTGTAAAGTGG + Intronic
1118608658 14:67522500-67522522 CAGTGTCCCCCCAGGCAGAGTGG - Intronic
1118704308 14:68466374-68466396 CAGTTTCCCCACCTGTAAAATGG - Intronic
1119118255 14:72047396-72047418 CAGTGTCCTCACGGGAAAAGGGG - Intronic
1119182990 14:72616911-72616933 CAGTTTCCCCATCTGGAAAGCGG - Intergenic
1119740467 14:77010756-77010778 CAGTTTCCCCACAAAGAAAATGG - Intergenic
1119760219 14:77145406-77145428 CAGTTTCCCCATAAGGAAAATGG - Intronic
1119815822 14:77566409-77566431 GAGTGTCCTCATATGTAAAGTGG - Intronic
1119871687 14:78023339-78023361 CAGTGTCCCCATATGAAAAATGG + Intergenic
1121011946 14:90524825-90524847 CAGTCTCCCCACCTGCAATGTGG - Exonic
1121091606 14:91186845-91186867 CAGTTTTCCCACATGGAGAATGG - Intronic
1121579333 14:95015188-95015210 CTGAGTCACCACATGGAGAGCGG - Intergenic
1121607537 14:95252293-95252315 CACTGTCCCCATACGGAAAGTGG + Intronic
1122074124 14:99224730-99224752 CAGTGTCCCCACCTGTAAAATGG - Intronic
1122191171 14:100044879-100044901 CACTGTCCCCAGTGGGAAAGTGG - Intronic
1122555966 14:102580262-102580284 CAGTGTCCTCCCCTGGAAAATGG + Intergenic
1122692230 14:103536827-103536849 CAGGGTCCGCACATGGAGAGCGG + Exonic
1122892562 14:104739566-104739588 CAGTCTCCCCACCTGCAAATGGG - Intronic
1122966118 14:105127018-105127040 GAGTGTCAACAAATGGAAAGAGG - Intergenic
1123472988 15:20568609-20568631 CAGTGTCCCCATCAGCAAAGAGG + Intergenic
1123645018 15:22431744-22431766 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1123666309 15:22611520-22611542 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1123733289 15:23163600-23163622 CAGTGTCCCCATCAGCAAAGAGG + Intergenic
1123751423 15:23360975-23360997 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124155558 15:27222290-27222312 CAGTGCACCCACATGCAAAATGG + Intronic
1124283793 15:28384893-28384915 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124298904 15:28526720-28526742 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124320130 15:28705926-28705948 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124482382 15:30089491-30089513 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124488841 15:30141593-30141615 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1124521195 15:30407718-30407740 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124537465 15:30558502-30558524 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124543924 15:30610557-30610579 CAGTGTCCCCATCAGGAAAGAGG + Intronic
1124754690 15:32396730-32396752 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124761191 15:32449085-32449107 CAGTGTCCCCATCAGCAAAGAGG - Intronic
1124777443 15:32599978-32600000 CAGTGTCCCCATCAGCAAAGAGG + Intronic
1124959372 15:34383262-34383284 CAGTGTCCCCATGAGCAAAGAGG - Intronic
1124975998 15:34529483-34529505 CAGTGTCCCCATGAGCAAAGAGG - Intronic
1125237167 15:37528907-37528929 CTGTGTCCTCACATGGCAAGGGG + Intergenic
1125881927 15:43202649-43202671 CAGGGTAGACACATGGAAAGAGG + Intronic
1126200343 15:45978678-45978700 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1126541408 15:49828486-49828508 CAGTGTCCTCACATGGTGAAAGG + Intergenic
1126991193 15:54377704-54377726 CTGTGTCCTCACATGGCAAAAGG + Intronic
1127127192 15:55823148-55823170 CAATGTCCCCAGATGGAGATAGG + Intergenic
1128069136 15:64783131-64783153 CAGGGGCTCCACATGGAATGAGG + Intergenic
1128361196 15:66963002-66963024 CAGTTTCCCCATCTTGAAAGTGG + Intergenic
1128629832 15:69253324-69253346 CAGTGTTCCCACAGGGTGAGTGG - Intronic
1128740443 15:70079840-70079862 CAGTTTCCCCATCTGAAAAGTGG - Intronic
1128806644 15:70536089-70536111 CAGTGTTCCCATCTGGAAAAGGG - Intergenic
1129258718 15:74350469-74350491 CAGTTTCCCCATCTGTAAAGTGG + Intronic
1129323710 15:74788739-74788761 CAGTCTCCCCACCTAGAATGTGG + Intronic
1129461240 15:75701039-75701061 CAGTGTCCCCATCTGTAAAAGGG + Intronic
1129504332 15:76068643-76068665 CTGTGTCCTCACATGGAAGCAGG - Intronic
1129512325 15:76133564-76133586 CAGTTTCCCCACCTGAAAAATGG - Intronic
1129608389 15:77035756-77035778 CAGTGTCCCCAGAAGGGGAGGGG + Intronic
1129723586 15:77890699-77890721 CAGTGTCCCCATCTGTAAAAGGG - Intergenic
1129802358 15:78424852-78424874 CAGTTTCCCCAGCTGTAAAGTGG - Intergenic
1129839382 15:78734406-78734428 CAGGGTCCCCATAAGCAAAGAGG + Intergenic
1129876999 15:78982116-78982138 CAGTGTCCCCATCTGGAAAATGG + Intronic
1129880331 15:79002418-79002440 CAGTTTACCCACGTAGAAAGTGG + Intronic
1130259716 15:82345627-82345649 CAGTGTCCCCATCAGTAAAGAGG - Intronic
1130269003 15:82433809-82433831 CAGTGTCCCCATCAGTAAAGAGG + Intronic
1130281517 15:82523382-82523404 CAGTGTCCCCATCAGTAAAGAGG + Intergenic
1130472890 15:84239565-84239587 CAGTGTCCCCATCAGTAAAGAGG + Intronic
1130480381 15:84354136-84354158 CAGTGTCCCCATCAGTAAAGAGG + Intergenic
1130491388 15:84433993-84434015 CAGTGTCCCCATCAGTAAAGAGG - Intergenic
1130503004 15:84513033-84513055 CAGTGTCCCCATCAGTAAAGAGG - Intergenic
1130595183 15:85244199-85244221 CAGTGTCCCCATCAGTAAAGAGG + Intergenic
1130885366 15:88088175-88088197 CAGTTTCCCCACCTGTAAAATGG + Intronic
1130949293 15:88572977-88572999 CAGTTTCCTCACCTGCAAAGTGG + Intergenic
1131282807 15:91034504-91034526 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1131697216 15:94890809-94890831 CAGTTTCCTCACCTTGAAAGTGG + Intergenic
1132331594 15:101015749-101015771 CAGTCTCCCCACGTGCAAAATGG - Intronic
1132433015 15:101775713-101775735 CAGTGTCCCCATCAGCAAAGAGG - Intergenic
1132696151 16:1202848-1202870 CAGCGTCCCCACCTAGAAGGGGG - Intronic
1132871373 16:2117143-2117165 CAGTTTCCCCATCTGGAAAGGGG - Intronic
1132873942 16:2127722-2127744 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1133221886 16:4322440-4322462 AGGTTTCCCCACATGGAAAATGG + Intronic
1133832829 16:9339954-9339976 CAGTGTCCTCATTTGGAAAGTGG + Intergenic
1133973222 16:10581420-10581442 CAGTTTCCCCATCTGGAAACTGG + Intergenic
1134131138 16:11651018-11651040 CAGTTTCCCCACCTGGGAAGTGG - Intergenic
1134197189 16:12168353-12168375 CAGTTTCCTCACATGCAAAGGGG - Intronic
1134308509 16:13055201-13055223 CAGTTTCCCCACCTGTAAAATGG - Intronic
1134521154 16:14919751-14919773 CAGTTTCCCCATCTGGAAAGGGG + Intronic
1134550417 16:15136221-15136243 CAGTTTCCCCATCTGGAAAGGGG - Intronic
1134553029 16:15146896-15146918 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1134708830 16:16318402-16318424 CAGTTTCCCCATCTGGAAAGGGG + Intergenic
1134716041 16:16358436-16358458 CAGTTTCCCCATCTGGAAAGGGG + Intergenic
1134809058 16:17151519-17151541 CAGTGTCCCCATCTGGAAAATGG + Intronic
1134822735 16:17259665-17259687 CAGTTTCCCCATCTGGAAATAGG + Intronic
1134950775 16:18350243-18350265 CAGTTTCCCCATCTGGAAAGGGG - Intergenic
1134958715 16:18393723-18393745 CAGTTTCCCCATCTGGAAAGGGG - Intergenic
1135178812 16:20255310-20255332 CAGTGTCCTCACTTGTAAAATGG + Intergenic
1135205774 16:20482692-20482714 CAGTGTTCCCATCTGTAAAGTGG - Intronic
1135330403 16:21555493-21555515 CAGTTTCCCCATCTGTAAAGTGG + Intergenic
1135471444 16:22734854-22734876 CACTGTTCCCCCAAGGAAAGCGG - Intergenic
1135545013 16:23359778-23359800 CAGTTTCCTCACCTGGAAAGTGG + Intronic
1135621503 16:23959867-23959889 CAGTGTCCCCATCTGCAAAGTGG - Intronic
1137454683 16:48609562-48609584 CAGTTTCCCCATTTGTAAAGTGG - Intronic
1137467880 16:48727565-48727587 CTGTGTCCTCACATGCAAGGAGG + Intergenic
1137707837 16:50548028-50548050 CAGTTTCCCCACCTGTAAATTGG + Intergenic
1137719548 16:50620032-50620054 CAGTTTCCCCATCTGGAAAATGG + Intronic
1137868250 16:51923815-51923837 CAATTTCCCCACATGTCAAGTGG - Intergenic
1137868406 16:51925916-51925938 CAGTTTCCCCACATGTCAAGTGG - Intergenic
1137870755 16:51947856-51947878 AAGTTTCCCCACCTGCAAAGTGG - Intergenic
1137888983 16:52138223-52138245 CAGTTTCCCCATCTGTAAAGTGG + Intergenic
1138247092 16:55475866-55475888 CTGTGCCCTCACATGGAAATAGG - Intronic
1138354741 16:56368157-56368179 CAGAGGCCCCAAATGGGAAGGGG + Intronic
1139314781 16:66059009-66059031 CAGTTTCCCCATCTGTAAAGTGG - Intergenic
1139667768 16:68470438-68470460 CAGTTTCCCCACCTGCCAAGTGG - Intergenic
1139706414 16:68743852-68743874 CAGTTTCCCCACCTGTAAAATGG + Intronic
1140066857 16:71618729-71618751 AAGTGTCCTCACATGGTAAAAGG - Intergenic
1140211133 16:72971433-72971455 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1140469557 16:75206543-75206565 CAGTGTCCCCATCAGCAAAGTGG + Intronic
1140716720 16:77733358-77733380 CAGTGTCCTTACAGGGAAAGGGG + Intronic
1140946020 16:79769141-79769163 CCGCGTCCTCACCTGGAAAGAGG + Intergenic
1141127123 16:81408717-81408739 CAGTTTCCCCACCTGAAAAATGG - Intergenic
1141344821 16:83234767-83234789 CAGTTTCTCCACATGCAAAGTGG - Intronic
1141394584 16:83693221-83693243 CAGTGTCCCCACCTGAAACATGG + Intronic
1141497773 16:84421774-84421796 CAGTTTCCCCATATGCAAAATGG + Intronic
1141628867 16:85276095-85276117 CAGTTTCCCCATCTGTAAAGTGG - Intergenic
1141969627 16:87472263-87472285 CTGTGTCCCCATCTGTAAAGTGG + Intronic
1142001846 16:87668799-87668821 CACTGTCCCCACAGTGAAAATGG + Intronic
1142123819 16:88400374-88400396 CAGTCTCCCCATCTGGAAAATGG - Intergenic
1142125700 16:88409230-88409252 CAGTTTCCCCACCTGCAAAGAGG + Intergenic
1142230417 16:88897615-88897637 CAGTTTCCCCACCTGTAAAATGG - Intronic
1142486579 17:251394-251416 CAGTTTCCCCACCTGAAAAGTGG - Intronic
1142507276 17:372534-372556 CTGTGTCCTCACATGGCAGGAGG - Intronic
1142581647 17:946772-946794 CAGTGTCCTCACCTGGAAAATGG + Intronic
1142692859 17:1617292-1617314 CAGTCTCCCCACATGGACAGAGG - Intronic
1143204216 17:5131559-5131581 CAGTGTCCCCATGGGGAAGGGGG + Intronic
1143262412 17:5609453-5609475 CAGTTTCCTCACCTGTAAAGTGG - Intronic
1143831573 17:9656207-9656229 CAATGTCCCCAAATGGTATGAGG - Intronic
1143897884 17:10150967-10150989 CAGTTTCCCCACCTGTAAAATGG + Intronic
1143976656 17:10835378-10835400 CAGTTTCCTCACCTGCAAAGTGG - Intronic
1144516066 17:15918142-15918164 CTGTGTCCTCACTTGGACAGAGG + Intergenic
1145267541 17:21387582-21387604 CAGTTTCCTCACCTGGGAAGTGG + Intronic
1146186724 17:30729074-30729096 CAGTCTCCTCACATGGGAAATGG - Intergenic
1146297139 17:31659114-31659136 CTGTGTGCTCACATGGAATGGGG + Intergenic
1146415023 17:32623825-32623847 TAGTGTCCTCACATGGCAAAAGG + Intronic
1146487087 17:33251700-33251722 CAGTTTCCCCATATGCAAAGTGG - Intronic
1146527113 17:33576580-33576602 CAATGTCCTCCAATGGAAAGTGG + Intronic
1146884008 17:36458993-36459015 CAGTGTCCCCAGCTAGAAAAAGG - Intergenic
1146931729 17:36782655-36782677 CAGTTTCCCCACATGCAAAAGGG + Intergenic
1147127107 17:38378670-38378692 CAGTGCTCCCAAATGGAGAGAGG - Intronic
1147357668 17:39910453-39910475 CAGTATCTTTACATGGAAAGTGG - Intronic
1147448479 17:40489283-40489305 CAGTTTCCACACCTGTAAAGTGG + Intronic
1147494125 17:40899731-40899753 CACTTTCCTCATATGGAAAGTGG + Intergenic
1147564903 17:41529980-41530002 CAGTTTTCCCTCATGAAAAGAGG + Intergenic
1147605690 17:41772578-41772600 CAGTGTCCTCATCTGTAAAGCGG + Intronic
1147614456 17:41819979-41820001 CAGTGTCCTCACCTGTCAAGTGG + Intronic
1147842111 17:43379084-43379106 CAGTTTCCCCAGCTGGGAAGTGG + Intergenic
1148065130 17:44863593-44863615 CAGTATCCCCACACAGGAAGGGG + Intronic
1148483069 17:47972813-47972835 CAGTTTTCCCACATGTAAAATGG - Intronic
1148798877 17:50210792-50210814 CAGTGTCCCCACCTGGGAAATGG - Intergenic
1148889543 17:50798091-50798113 GCCTGTCCCCACAAGGAAAGGGG - Intergenic
1148971937 17:51491261-51491283 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1148985821 17:51620266-51620288 CTGTGTCCTCACATGGTAAAAGG + Intergenic
1149124431 17:53210548-53210570 CGGTGTCCTCACATGACAAGAGG - Intergenic
1149451185 17:56751296-56751318 CAGTGCCCCAAACTGGAAAGTGG + Intergenic
1150217949 17:63480691-63480713 CAGGGTCCCCACCTGTAAAGTGG - Intergenic
1150222789 17:63506719-63506741 CAGTCTCCCCACCTGTAAAATGG + Intronic
1150916478 17:69442810-69442832 CAGTTTCCCCATCTGTAAAGTGG + Intronic
1151389090 17:73773690-73773712 CAGTTTCCTCATATGAAAAGTGG - Intergenic
1151878482 17:76880715-76880737 CAGTCTCCCCACCTGGGGAGGGG - Intronic
1151901820 17:77020995-77021017 CAGTTTCCCCACCTGTAAAATGG - Intergenic
1151950016 17:77346892-77346914 CTGTGTCCCCACATGGCAGAAGG - Intronic
1152179989 17:78813447-78813469 CAGCTTCCCCACACGGGAAGGGG + Intronic
1152248040 17:79196115-79196137 GAGTGTCCCAAGATGGGAAGTGG + Intronic
1152575278 17:81137289-81137311 CAGTGTCCTCATCTGCAAAGTGG - Intronic
1152778113 17:82214468-82214490 CAGTGTCCCTGCCTGTAAAGTGG + Intergenic
1152871624 17:82756930-82756952 CAGTGTCCCCATCTGTAAACTGG - Intronic
1153235666 18:2984710-2984732 CAGTTTCCTCACATTTAAAGTGG - Intronic
1153661932 18:7333204-7333226 CATTTTACCCACATGGGAAGTGG - Intergenic
1154353536 18:13607250-13607272 CAGTTTCCCCATCTGTAAAGTGG + Intronic
1155395170 18:25379203-25379225 CAGTGTCTTCACCTGCAAAGTGG + Intergenic
1157323687 18:46654126-46654148 CTGTGTTCCCACATGGCAATAGG - Intronic
1157492653 18:48135466-48135488 CAGTTTCCCCATCTGCAAAGTGG + Intronic
1157504936 18:48219468-48219490 CAGTGTCCCCACCTGGAATGTGG - Intronic
1158149787 18:54355530-54355552 CAGTGTCCTCACATGGAAGAAGG - Intronic
1158340614 18:56461908-56461930 CAGTTTCTCCATATGTAAAGTGG - Intergenic
1158788205 18:60740989-60741011 CTGTGTCCCCACATGGCAGAGGG + Intergenic
1159482478 18:69007898-69007920 CAGTGTTCATACAAGGAAAGAGG - Intronic
1159765961 18:72488870-72488892 CATTGTCCTCACATTGAAAAAGG + Intergenic
1159904310 18:74076419-74076441 CAGTGTCCTCACCTGGTAAAAGG - Intronic
1160240770 18:77120764-77120786 AAGTGTCACTCCATGGAAAGAGG + Intronic
1160691227 19:461368-461390 CAGTTTCCCCACTAGGAAATAGG - Intergenic
1160773993 19:846484-846506 CAGTCTCCCCACCTGGAAGGTGG + Intronic
1160870603 19:1276093-1276115 CAGTGGCCCCACCTGGGAAACGG - Intronic
1160925478 19:1542921-1542943 CAGTGTCCCCATCTGTATAGTGG - Intergenic
1161196627 19:2990029-2990051 CAGTTTCCCCACCTGGACACAGG + Intronic
1161225600 19:3143795-3143817 GAGTTTCCCCACATGGAAACAGG + Intronic
1161258065 19:3320642-3320664 CAGTTTCCCCATCTGTAAAGCGG - Intergenic
1161489275 19:4552938-4552960 CAGTGTCCCCACATGTACAATGG - Intronic
1161616911 19:5276025-5276047 CAGTTTCCTCACATGTAAAATGG - Intronic
1161625114 19:5322016-5322038 CAGTTTACCCAAATGGAAATGGG - Intronic
1161662997 19:5558796-5558818 CAGTTTCCCAACCTGGAAAATGG + Intergenic
1161940325 19:7398770-7398792 GAATGTCCCCACTTTGAAAGGGG + Intronic
1161965140 19:7543573-7543595 CAGTTTCCCCATATGGACAGTGG - Intronic
1162312485 19:9915071-9915093 CAGTTTCCCCATCTGCAAAGTGG + Intronic
1162312689 19:9916480-9916502 CAGTTTCCTCACCTGGAAATAGG - Intronic
1162389290 19:10379678-10379700 CAGTTTCCCCATCTGGAAAAGGG + Exonic
1162532690 19:11245030-11245052 CAGTTTCCCCATCTGGAAAATGG + Intronic
1163242730 19:16074414-16074436 CTGTGTCCTCACATTGGAAGAGG + Intronic
1163296989 19:16418789-16418811 CCGTGTCCTCACATGGCAAAAGG - Intronic
1163438668 19:17310465-17310487 CAGTCTCCCCACCTGAAAAGTGG + Intronic
1163522514 19:17799857-17799879 CAGTTTCCTCATCTGGAAAGTGG + Intronic
1163566082 19:18052111-18052133 CAGTTTCCCCACCTGGAAAGCGG + Intergenic
1163615137 19:18322744-18322766 CAGTTTCCCCACCTGCAAACTGG + Intronic
1163665550 19:18602277-18602299 CAGTTTCCCCATCTGGAAAGTGG + Intronic
1163726273 19:18924833-18924855 CGGTTTCCCCACATGGACAGTGG + Intronic
1163774748 19:19211693-19211715 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1163775435 19:19214629-19214651 CAGTTTCCCCACCTGTAAAATGG - Intronic
1163823727 19:19511182-19511204 CAGACTCCCCACTTGGAAAATGG - Intergenic
1164828146 19:31299316-31299338 CAGTCTCCCCACTTGAAAAATGG + Intronic
1164828207 19:31299668-31299690 CCGTGTCCACACATAGCAAGGGG + Intronic
1166175755 19:41068355-41068377 CAGTTTCCCCATCTGGAAAATGG + Intergenic
1166534273 19:43562409-43562431 CAGTTTCCTCACATGCAAAAAGG + Intronic
1166550671 19:43663971-43663993 CTGTGACCCATCATGGAAAGGGG + Intronic
1166782524 19:45349943-45349965 CAGTCTTCCCACACGCAAAGTGG - Exonic
1166943690 19:46384260-46384282 CAGTTTCCCCATTTGCAAAGAGG + Intronic
1167171327 19:47834249-47834271 CTGTGTCCTCACATGTAAAATGG - Intronic
1167217793 19:48176402-48176424 CAGTTTTCTCACCTGGAAAGTGG - Intronic
1167339232 19:48905035-48905057 CAGTTTCCCCACCTGTAAAATGG + Intronic
1167618795 19:50550151-50550173 CAGTGTCCCCATCTGTAAATTGG - Intronic
1167812814 19:51849489-51849511 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1167978428 19:53252343-53252365 CAGTGTGCCCACCTGTAACGTGG - Intronic
1168147144 19:54426164-54426186 CAGTTTCCCTACATGTAACGTGG - Intronic
1168297957 19:55386883-55386905 CCGTGTCCTCACCTGTAAAGTGG + Intronic
924996812 2:368819-368841 CTGTGTCCTCACATGGAGGGAGG + Intergenic
925409683 2:3632805-3632827 CTGAGTCCCCACTTGGAGAGGGG + Intronic
925875729 2:8309758-8309780 CAGTTTCCTCACATGAAAATGGG + Intergenic
926233612 2:11023172-11023194 GAATGTCCCCACGTGGACAGAGG + Intergenic
926423909 2:12724215-12724237 CAGTTTCCTCACCTGGAATGCGG - Intronic
926621932 2:15054484-15054506 CAGTTTCCTCAACTGGAAAGCGG - Intergenic
926716218 2:15926015-15926037 CAGTTTCCTCAGATGTAAAGTGG + Intergenic
926784631 2:16507901-16507923 CAGTCTCCCCACCTGCAAAGTGG - Intergenic
926808418 2:16734715-16734737 CAGTGTCTCCACAAGGGAACAGG - Intergenic
926913550 2:17873039-17873061 CAGTGTCCTCACAGGAAGAGGGG - Intergenic
927476400 2:23417538-23417560 CAGTGTCTCCATCAGGAAAGTGG - Intronic
927712236 2:25333014-25333036 CTGGGTCCCCACATGGACAGGGG + Intronic
928059931 2:28101589-28101611 CAGGTTCCCCACATGGACTGGGG - Intronic
928245884 2:29626645-29626667 CTGTGTCCTCACATGGGGAGGGG - Intronic
928658548 2:33478006-33478028 CAGTGTTCCCTCATGGCAGGGGG - Intronic
929446295 2:42003957-42003979 CTGTGTGCTCACATGGGAAGGGG + Intergenic
929783874 2:44975344-44975366 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
930207418 2:48602065-48602087 CCGTGTCCTCACATGGCAGGAGG + Intronic
930699366 2:54444130-54444152 CAGAGTCCCCACCTGTAAAGTGG + Intergenic
931692358 2:64846028-64846050 CAGTTTCCCCACTTGTAAAATGG + Intergenic
931863807 2:66388030-66388052 CAGTTTCCCCATCTGTAAAGTGG - Intergenic
932066231 2:68564655-68564677 CAGTTTTCCCACATGTAAAAGGG - Intronic
932411852 2:71552299-71552321 CAGTTTCCCTATCTGGAAAGTGG + Intronic
932420814 2:71600263-71600285 CAGTTTCCCCATTTGCAAAGTGG + Intronic
932490469 2:72116668-72116690 CAGTTTCCTCACATGCAAAAAGG + Intergenic
932714672 2:74092717-74092739 CAGTGTCCCCAGCTGTGAAGTGG + Intronic
933558172 2:83857766-83857788 CTGTGTCCCCACATGGCAAAAGG - Intergenic
934539349 2:95161057-95161079 CTGTGTCCTCACATGGCAGGAGG - Intronic
934609804 2:95726704-95726726 CAGGGTCCTCACATGGCAGGGGG + Intergenic
934687372 2:96331553-96331575 CAGTTTCCTCACATGTAAAATGG - Intergenic
934753504 2:96809561-96809583 CAGTGGGCCCACATGAAGAGAGG + Exonic
934971439 2:98767655-98767677 CAGTTTCCTCATATGCAAAGTGG - Intergenic
934974680 2:98792525-98792547 CAGTTTCCTCACCTGCAAAGTGG + Intergenic
935043038 2:99452960-99452982 CAGTTTCCTCACATGTAAACTGG + Intronic
935170934 2:100611139-100611161 CGGTCTCCCCTCATGGAAAATGG + Intergenic
936165491 2:110116242-110116264 CAGTCTCCTCACTTGGAAAAGGG - Exonic
936373818 2:111924299-111924321 CAGTTTGCTCACAGGGAAAGTGG - Intronic
937676894 2:124601055-124601077 AAGTGTCCACAACTGGAAAGAGG - Intronic
937876833 2:126832359-126832381 CAGTTTCCCCACCTGTAAAGTGG + Intergenic
938100450 2:128494466-128494488 CAGTTTCCTCACATGTAAAATGG + Intergenic
938318716 2:130347666-130347688 CTGTGTCCTCACATGGCAGGAGG - Intronic
938861711 2:135376043-135376065 CAGTGTCCCTATAAGGGAAGAGG + Intronic
939363627 2:141205426-141205448 CAGGCTCTCCACATGGAATGGGG + Intronic
939988457 2:148855183-148855205 CTGTGTCCCCACATGGCAGAAGG - Intergenic
939996503 2:148925649-148925671 CTGTGTGCCCACCAGGAAAGGGG - Intronic
940060429 2:149559540-149559562 CAGTGTCCTCACATGGCAAAGGG + Intergenic
941049851 2:160720672-160720694 CAGTTTCCCCACCTGTAAAATGG + Intergenic
941067860 2:160923732-160923754 CAGTTTCCCCACCTAGACAGTGG - Intergenic
941094862 2:161227509-161227531 CAGTTTCTTCACATGTAAAGTGG + Intronic
941160194 2:162026677-162026699 CTGTTTCCCGGCATGGAAAGTGG - Intronic
942287368 2:174433683-174433705 CTGTGTCCCCACATGGTAGATGG - Exonic
943200960 2:184823193-184823215 CAGTGTCTTCACATGGCAAAGGG + Intronic
943281702 2:185943027-185943049 CTGTGTCCTCACGTGGAAAGTGG + Intergenic
943709173 2:191071186-191071208 CAGTTTCCTCACATGAAAAATGG - Intronic
944910517 2:204306155-204306177 CAGTGTCCCCATCTGTAAAATGG - Intergenic
945869763 2:215214365-215214387 CTGTTTCCCTACAGGGAAAGGGG - Intergenic
946021088 2:216640608-216640630 CAGTGTCCACACCTGCAAAATGG - Intronic
946166661 2:217868665-217868687 CAGTGTTCTCACCTGTAAAGTGG - Intronic
946866738 2:224047657-224047679 CTGTGTCCTCACATGGCAGGAGG - Intergenic
947745904 2:232507159-232507181 CAGTGGCCCCGCGTGAAAAGGGG + Intergenic
947842706 2:233218636-233218658 CTGTGTCACCCCATGCAAAGAGG + Intronic
947845134 2:233237701-233237723 CTGTGTCCTCACATGGTAGGAGG + Intronic
947851644 2:233293310-233293332 GAGTGTGCTCACAGGGAAAGTGG + Exonic
948150235 2:235739135-235739157 CAGTGTCCCCAGATGCAAAGGGG - Intronic
948301831 2:236913524-236913546 CAGTTTCCTCATCTGGAAAGCGG - Intergenic
948395450 2:237642108-237642130 CAGTGTTTCCACCTGGCAAGGGG + Intronic
948512789 2:238481748-238481770 CAGTGTCCCCATCTGTAAAGTGG - Intergenic
948574023 2:238938279-238938301 CAGTGTCCAGACATGGCAGGAGG + Intergenic
948597573 2:239090089-239090111 CAGTGACACCATATGGAACGAGG - Exonic
948867395 2:240782834-240782856 CAGTTTCCCCGCCTGTAAAGTGG - Intronic
1168984769 20:2038719-2038741 CAGTTTCCCCATCTGGAAAATGG + Intergenic
1169034412 20:2437890-2437912 CAGTTTCCTCATTTGGAAAGAGG - Intergenic
1169737538 20:8852999-8853021 GAGTGTCACCACCTGGAAAGTGG + Intronic
1169958443 20:11131855-11131877 CAGTATCCTCAGATGGAATGAGG + Intergenic
1170666980 20:18394847-18394869 CAGTTTCCTCACCTGGAAAGTGG + Intronic
1170808672 20:19656276-19656298 CAGTGTCCCCAGATTAAAACAGG + Intronic
1171534055 20:25870603-25870625 CAGTGTCCTCACATGGCAGAAGG + Intergenic
1172126172 20:32626626-32626648 CAGTCTCCCCATCTGGAAAATGG + Intergenic
1172226585 20:33309485-33309507 CAGTGTCCCCATCTGCAAAATGG + Intronic
1172754580 20:37274174-37274196 CAGTTTCCCCATCTGCAAAGTGG - Intergenic
1172764742 20:37345630-37345652 CAGTTTCCCCATCTGTAAAGTGG + Intronic
1172770570 20:37380095-37380117 CAGTTTCCTCATCTGGAAAGTGG + Intronic
1172775588 20:37404817-37404839 CAGTGTGCCCATCTGTAAAGGGG + Exonic
1172789661 20:37494150-37494172 CAGTGTCCTCACATAGGAAATGG - Intronic
1173132663 20:40409095-40409117 CAGTTCCCCCATATGTAAAGTGG - Intergenic
1173620595 20:44433044-44433066 CAGTCTCCTCATCTGGAAAGTGG - Intergenic
1173862844 20:46295534-46295556 CAGTTTCCCCATCTGTAAAGTGG - Intronic
1173898163 20:46566485-46566507 CAGTCTCCCCATCTGGGAAGGGG - Intronic
1173912108 20:46678085-46678107 CAGTTTCTCCACCTGTAAAGTGG - Intronic
1173925832 20:46780526-46780548 CAGTGCCACCCCATGGAAAAGGG - Intergenic
1174047695 20:47745314-47745336 CAGTTTCCCCATCTGCAAAGCGG + Intronic
1174300601 20:49579573-49579595 CAGTTTCCTCACCTGGAAAGTGG - Intergenic
1174345098 20:49923246-49923268 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1174391572 20:50221202-50221224 CAGTTTCCCCATTTGTAAAGTGG + Intergenic
1174550155 20:51356350-51356372 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1175060393 20:56236846-56236868 CAGTGTCTCCATCTGTAAAGTGG + Intergenic
1175247124 20:57588931-57588953 CAGTTTCCCCATCTGTAAAGTGG - Intergenic
1175391279 20:58628924-58628946 CAGTTTCTCCACAAGTAAAGTGG - Intergenic
1175480681 20:59308576-59308598 CAGTGTCCCCATCTAGAGAGTGG + Intronic
1175578095 20:60077890-60077912 CAGTTTCCCCATCTGTAAAGTGG + Intergenic
1175726035 20:61319241-61319263 CAGTTTCCCCACCTGTAAAATGG - Intronic
1175726454 20:61321981-61322003 CAGTTTCCCCACCTGTAAAATGG - Intronic
1175967376 20:62666282-62666304 CAGTTTCCCCACCTGTAAAGTGG + Intronic
1178231456 21:30789748-30789770 CTGTGTCCCCACATGGCAAAGGG - Intergenic
1178269540 21:31177231-31177253 CAGTGTCCTCACCTGCAAAATGG - Intronic
1178308893 21:31513280-31513302 CAGTTTCCCCACCTGTAAAATGG - Intronic
1178662612 21:34520290-34520312 CAGGGTCTCCACTTGCAAAGAGG - Intronic
1178793473 21:35721993-35722015 CAGTGTAGCCACAAGGAGAGAGG - Intronic
1179418351 21:41216193-41216215 CAGTGTCACCACACAGAAAATGG + Intronic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1180181721 21:46121174-46121196 GGCTGTCCCCACATGGATAGGGG - Intronic
1180955386 22:19739088-19739110 TAGTTTCCCCACATGTAAAATGG + Intergenic
1180991766 22:19941497-19941519 CAGTTTCCCCACCTGGGAAGGGG + Intronic
1181141578 22:20809272-20809294 CAGTTTCCCCATATGTAAACTGG + Intronic
1181477595 22:23178515-23178537 CAGTTTCCTCACATGCAAAATGG + Intergenic
1181518982 22:23434549-23434571 CAGTGTCCCCACCTGTGAAATGG - Intergenic
1181555661 22:23670434-23670456 CAGTTTCCCCACATGTAAGCAGG - Intergenic
1181684093 22:24516579-24516601 CAGTGTCCCCAGCAGGACAGGGG + Intronic
1181849736 22:25741623-25741645 CAATTTCCCCACTTGTAAAGTGG + Intergenic
1181922081 22:26328390-26328412 CAGTGTTCCCACCTGTAAAATGG - Intronic
1182062183 22:27406185-27406207 CAGTTTCCCCACCTGGAAGGAGG - Intergenic
1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG + Intronic
1182135858 22:27902326-27902348 CAGTGACCAAACATGGAGAGAGG + Intronic
1182282085 22:29223767-29223789 CAGTTTCCCTACCTGGAAAGTGG + Intronic
1182547836 22:31085849-31085871 CAGTGTCCCCATCTGGAAAATGG - Intronic
1182810246 22:33110127-33110149 CAATGTCCCCACTTAGAAAATGG - Intergenic
1183095230 22:35547957-35547979 CAGTTTCCCCACTTGTAAAAAGG - Intronic
1183100491 22:35580747-35580769 CAGTTTCCTCACCTGGAAAATGG + Intergenic
1183138969 22:35918017-35918039 CAGTTTCCCCAAATGTAAAACGG + Intronic
1183349229 22:37325328-37325350 CAGTTTCCCCACCTGTAAAGTGG - Intergenic
1183352103 22:37340164-37340186 CAGTCTCCCCTCCTGGAAGGTGG - Intergenic
1183456580 22:37926210-37926232 CAGTCTCCTCACCTGCAAAGTGG - Intronic
1183655563 22:39182680-39182702 CAGTGTTCCCACCTGAAAAATGG + Intergenic
1183940093 22:41289242-41289264 CAGTCTCCCCATTTGTAAAGAGG - Intergenic
1184001805 22:41680180-41680202 CAGAGGCCCCAGATGGAAACAGG + Intronic
1184344854 22:43907122-43907144 CAGTTTCCCCACCTATAAAGTGG - Intergenic
1184473995 22:44710953-44710975 CAGTGTCCCCATCTGGAAAATGG - Intronic
1184566212 22:45293636-45293658 CAGTTTCCCCATCTGGAAAATGG + Intronic
1184645517 22:45892682-45892704 CAGTTTCCCCACTTGTAAAATGG - Intergenic
1184650575 22:45917783-45917805 CTGTGTCCCCTCATGGGAGGAGG + Intergenic
1185356946 22:50378993-50379015 CTGTGTCCTCACATGGCAAAAGG - Intronic
949129286 3:482103-482125 CAGTAACCCCTCATGGCAAGTGG - Intergenic
949432315 3:3991130-3991152 CTGTGTCCTCACATGGCAAAAGG + Intronic
949606089 3:5655823-5655845 CAGTTTCCCCATCTGTAAAGTGG + Intergenic
949761793 3:7479041-7479063 CAGTGTACCCATATGTAAAGTGG + Intronic
949877480 3:8635642-8635664 CAGGGCCCCCCCAGGGAAAGGGG + Intronic
950053434 3:10008593-10008615 CAGTTTCCTCACCTGGACAGTGG - Intronic
950168204 3:10817007-10817029 CAGTGTCCTCACCTGCAAAATGG - Intronic
950173924 3:10858628-10858650 CAGTGTGCCCACCTATAAAGTGG - Intronic
950305072 3:11910878-11910900 CAGTTTCCTCACCTGGACAGTGG - Intergenic
952004036 3:28821845-28821867 CTGTGTCCTCACATGGCAATAGG + Intergenic
952583526 3:34863999-34864021 CAGTGTCTCCATATGTAAAATGG - Intergenic
953011376 3:39028339-39028361 CAGTGTCAGAACATGGGAAGAGG - Intergenic
953220939 3:40971043-40971065 AAGTGTCCCCACAGGGACAATGG - Intergenic
953408260 3:42671170-42671192 CAGTGTCCCCTTTTGGGAAGAGG - Intergenic
953852593 3:46477561-46477583 CAGTGTCCCCATGTGAAAATAGG + Intronic
953879894 3:46686189-46686211 CAGTTTCCCTATATGGAAGGGGG - Intronic
954674748 3:52309561-52309583 CAGTGTCCCCACCTGCAAAAAGG + Intergenic
954710638 3:52503633-52503655 CAGTTTCCCCACTTGTAAAGTGG + Intronic
954799206 3:53177493-53177515 CAGTTTCCCCATCTGAAAAGTGG + Intronic
955009448 3:54999986-55000008 CTGTGTGCCCACATGGATGGTGG - Intronic
955040111 3:55308236-55308258 CCGTGTCCTCACAAGGCAAGGGG + Intergenic
955523186 3:59794964-59794986 CAGTTTCCTCACCTGTAAAGTGG + Intronic
956493369 3:69798118-69798140 CAGTCTCCCCATGTGTAAAGTGG + Intronic
956731173 3:72198002-72198024 CAGTGTCCCAGCATGTAAAATGG - Intergenic
956857891 3:73293994-73294016 CAATTTCCTCACATGTAAAGAGG - Intergenic
957429434 3:80083124-80083146 CAGTGTTCTCACATGGCAAAAGG + Intergenic
959126834 3:102300115-102300137 CAGAGTCCTCACATGGCAGGAGG + Intronic
959268135 3:104169746-104169768 CAGCATCCCCACAGGTAAAGAGG - Intergenic
960356429 3:116659209-116659231 CTGTGTCCTCACATGGGAGGTGG - Intronic
960677881 3:120214546-120214568 CAGATTCCCAACATTGAAAGGGG + Intronic
960743513 3:120860909-120860931 CAGTGTCCTCATCTGGAAAATGG - Intergenic
960985549 3:123278157-123278179 CAGTTTCCTCAGATGTAAAGTGG + Intergenic
962635623 3:137328402-137328424 CAGTTTCCCCACCTGTAAAATGG - Intergenic
964653700 3:159042808-159042830 CAGTTTCCCCATCTGCAAAGTGG - Intronic
965230901 3:166051835-166051857 CTGTGTCATCACATGGTAAGAGG - Intergenic
966440331 3:179937881-179937903 CAGTTTCCTCATCTGGAAAGTGG + Intronic
966561531 3:181325721-181325743 CAGTGCAGCCACATGGGAAGTGG + Intergenic
966641526 3:182196401-182196423 CAGTGTCCCCATTTGTAAAGTGG - Intergenic
966886023 3:184378605-184378627 CCGTGTTCCCACTTCGAAAGGGG - Intronic
967822194 3:193848548-193848570 CTGTGTCCTCACATGGCAAAAGG - Intergenic
967959754 3:194911067-194911089 CTGTGTCCTCACATGGCAGGAGG + Intergenic
968603762 4:1521970-1521992 TCGGGTCCCCACCTGGAAAGAGG + Intergenic
968618830 4:1594386-1594408 CAGTTTCCCCTCATGAAAAAAGG + Intergenic
968658184 4:1787555-1787577 CAGTTTCCCCACCTGTCAAGTGG + Intergenic
968704379 4:2071178-2071200 CAGTTTCCCCACGTGCAAAGAGG + Intergenic
968969298 4:3785225-3785247 CAGTTTCCCCATCTGCAAAGTGG - Intergenic
969090364 4:4689553-4689575 CAGTGGCACCACCTGGAAAAGGG - Intergenic
969134708 4:5020516-5020538 CAGTTTTCCCACCTGGAAAATGG - Intergenic
969354663 4:6618460-6618482 CAGTTTCCCCCCATGTAAAATGG + Intronic
969394585 4:6911720-6911742 CTGTGTCCCCACTTTGAGAGAGG - Intronic
969477576 4:7430175-7430197 CACTGTTCCCACATTGAAGGTGG + Intronic
969481110 4:7447425-7447447 CAGTGTTCCCATCTGGAAAATGG - Intronic
969530495 4:7727742-7727764 CAGTTTTCTCACATGTAAAGTGG - Intronic
969616027 4:8253031-8253053 CAGTTTCCCCACCTGTAATGTGG + Intergenic
969838995 4:9866796-9866818 CAGTTTACCCACATGTAAAATGG - Intronic
970209878 4:13698080-13698102 CTGTGTCCTCACATGGTAAAAGG + Intergenic
970918662 4:21367035-21367057 CTGTGTCCTCACATGGCAGGAGG - Intronic
971163814 4:24161503-24161525 CAGTTTCCTCACCTGGAAAATGG + Intergenic
971173480 4:24258299-24258321 CAGTATCCCCATCTGCAAAGTGG - Intergenic
971562320 4:28095801-28095823 CAATGCACCCACAGGGAAAGGGG - Intergenic
971718471 4:30213312-30213334 CAGTGTCCTCACTTGAAAAATGG - Intergenic
972309321 4:37865127-37865149 CAATGTTCCCCAATGGAAAGAGG - Intergenic
973684909 4:53359871-53359893 GAGTGGCCCCACATTGAATGAGG - Intronic
973735990 4:53872194-53872216 CTGTGTCTCCACATGAAAAAAGG - Intronic
974082741 4:57229751-57229773 CAGTGTCCACACCTGCAAATTGG + Intergenic
974702728 4:65472396-65472418 CAGTGTCCCCACTGGGGAACTGG - Intronic
976929811 4:90552007-90552029 CTGTGTCCCCACATGGAGAAAGG + Intronic
977644026 4:99391026-99391048 CTGTGTACTCACATGGAAAAAGG + Intergenic
977931351 4:102752619-102752641 TCATGCCCCCACATGGAAAGTGG - Intronic
978156008 4:105489864-105489886 CTGTGTCCTCACATGGTAAAAGG - Intergenic
978239793 4:106501891-106501913 AAGTCTCCCCAGATGGAAACAGG + Intergenic
978623069 4:110653941-110653963 CTGTGTGCTCACGTGGAAAGGGG - Intergenic
978771770 4:112464730-112464752 CAGTAGCCACACATGGAAACAGG + Intergenic
979079719 4:116320712-116320734 CAGTGTCAGCAAATTGAAAGTGG + Intergenic
979322963 4:119345695-119345717 CAGTTTCCCCATCTGGAAAATGG + Intergenic
979486554 4:121277280-121277302 CAGTGTCCTCACATGTGAAATGG + Intergenic
981244006 4:142513363-142513385 CTGTGTCCTCACATGGTAGGAGG + Intronic
982720369 4:158853570-158853592 CAATGTCCCCACTTGGACACAGG - Intronic
983240799 4:165230344-165230366 CAGTTTCCCCATCTGGAAAATGG + Intronic
983860707 4:172702662-172702684 CACTGTCCTCACATGGAGGGAGG - Intronic
984399516 4:179243900-179243922 CTGTGTCCTCACATGGTAGGAGG + Intergenic
984755386 4:183321786-183321808 CAGTGTCCCTACCTGGAAGATGG - Exonic
984932497 4:184859426-184859448 CAGTGTCCCCATTTGTAAACTGG - Intergenic
985886982 5:2687441-2687463 CAGTTTCCCCACATGTAAACTGG + Intergenic
985972301 5:3388122-3388144 CAATGTCACTACATGCAAAGTGG + Intergenic
987236636 5:15949259-15949281 CAGTAACCACACATGGCAAGTGG - Intergenic
987973840 5:24985757-24985779 GAGTGTCCCCAGATAGAAACGGG + Intergenic
988821508 5:34890627-34890649 CAGTTTTCCCACATGTAAAATGG - Intronic
988908693 5:35817336-35817358 CTGTGTCCTCACCTGTAAAGGGG - Intergenic
988942938 5:36164211-36164233 CAGTCTCCCCATATGTAAATGGG + Intronic
989107582 5:37878311-37878333 CAGTCTCCCCACCTGTAAAATGG + Intergenic
989293330 5:39794406-39794428 CAGTGTCCCCACCAAAAAAGAGG + Intergenic
990091261 5:52052700-52052722 CTGTGTTCTCACATGGAAGGAGG + Intronic
990108256 5:52291480-52291502 CAGTGTCATCATATGAAAAGGGG + Intergenic
991349146 5:65702590-65702612 CTGTGTCCTCACATGGCAAGAGG + Intronic
991655007 5:68895242-68895264 CAGTTTCCCCACCTGTAAAATGG - Intergenic
991950889 5:71945946-71945968 CAGTGTGGCCACAAGGAGAGGGG + Intergenic
992723186 5:79580647-79580669 CAGTGTCCCCAGGCAGAAAGGGG - Intergenic
992938816 5:81741147-81741169 CAGTTTCCCCATATGTAAAATGG + Intronic
993284440 5:85973357-85973379 CTGTGTCCTCACATGGGGAGGGG - Intergenic
993514338 5:88811944-88811966 CAGTTTCCTCACCTGGAAAGTGG + Intronic
993816825 5:92558846-92558868 ATGTGTCCCCATATTGAAAGAGG + Intergenic
994015746 5:94962981-94963003 CTGTGTCCTCACATGGCAAAAGG + Intronic
995221180 5:109650018-109650040 CAGTGTCCCATCTTGGAAAATGG - Intergenic
995514096 5:112937120-112937142 CTGTGTCCCCACATGGCAGAAGG - Intergenic
995933500 5:117480813-117480835 CTGTGCCCTCACATGGTAAGGGG - Intergenic
996037107 5:118770778-118770800 CAGTTTCCCCATGTGGAAAATGG + Intergenic
996315635 5:122157750-122157772 CAATCTCCCAACCTGGAAAGTGG - Intronic
996752485 5:126902998-126903020 CAGTGTACCAGCATGGACAGTGG - Intronic
996775036 5:127123352-127123374 AAGTTTCCCCTCAGGGAAAGAGG + Intergenic
997345592 5:133189723-133189745 CAGTGGCCTCACAGGGAAATGGG - Intergenic
997506327 5:134420452-134420474 GAGTGTCCTCACATGGCAGGAGG + Intergenic
997658390 5:135572139-135572161 CAGTTTCCTCATATGCAAAGCGG - Intronic
997963612 5:138340194-138340216 CAGTTTACCCATATGTAAAGTGG - Intronic
998459164 5:142296657-142296679 CAGTTTCCCCATCTGGAAAATGG - Intergenic
998889846 5:146734443-146734465 CAGTTTCCTCACCTGCAAAGTGG - Intronic
999102630 5:149038963-149038985 CAGTCTCCCCAACTGGAAAATGG + Intronic
999447521 5:151652056-151652078 CAGTTTCCCCACCTGCATAGTGG + Intergenic
999931617 5:156439212-156439234 CAGTTTCCTCAAATGGAAAAAGG - Intronic
1000733429 5:164866482-164866504 CAGTAACCACACATGGATAGTGG + Intergenic
1001185668 5:169569284-169569306 CACTGTCCACACATGTAAAAGGG - Intergenic
1001230512 5:169983415-169983437 CAGTTTCCCCATTTGTAAAGTGG + Intronic
1001489043 5:172142757-172142779 CAGTTTCCCCATATGTAAAATGG - Intronic
1001562264 5:172677448-172677470 CAGTTTCCCCACTTGCAAAGTGG - Intronic
1001596813 5:172903748-172903770 CAGTTTCCCCAGATGTAAAATGG - Intronic
1001702663 5:173718600-173718622 CAGTATCCTCACCTGTAAAGTGG - Intergenic
1002135240 5:177103730-177103752 CAGTGTCCACATCTGGAAAATGG - Intergenic
1002613436 5:180436047-180436069 CAGTTTCCCCATCTGTAAAGGGG - Intergenic
1003644645 6:7904712-7904734 CAGTGTCCACACCTGGAACAAGG + Exonic
1004043002 6:12000353-12000375 CAGTGTCCCCATCTGTAAAATGG - Intergenic
1004826314 6:19425321-19425343 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1005353525 6:24960341-24960363 CTGTGTCCTCACATGGAGAAGGG + Intronic
1005878497 6:30034709-30034731 CTGTGTCTTCACATGGCAAGTGG - Intergenic
1005986336 6:30878050-30878072 CAGTCTTCCAAAATGGAAAGGGG - Intronic
1006399204 6:33806586-33806608 CAGTTTCCCCACATGTAAGTTGG - Intergenic
1006429961 6:33989281-33989303 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1006604153 6:35244192-35244214 CAGTGTCCCCTCTGGGAAATTGG - Intronic
1006779773 6:36624422-36624444 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1006812126 6:36826870-36826892 CAGTTTCCCCATCTGTAAAGTGG + Intronic
1006902484 6:37512118-37512140 CAGTGTGCTCATCTGGAAAGCGG - Intergenic
1007336751 6:41160025-41160047 CAGTTTCCCCACTTATAAAGTGG + Intronic
1007494460 6:42250122-42250144 CAGTTTCCCCACATGACATGGGG + Intronic
1009962959 6:70545787-70545809 CAGTGTCCTCATCTGCAAAGTGG - Intronic
1011403244 6:86987794-86987816 CAGTGTCCTCACATGGCAGAAGG + Intronic
1012443232 6:99281671-99281693 CTGTGTCCTCACATGGTAAAAGG - Intronic
1013470034 6:110455841-110455863 CAGTGTCCTCACATGGAAGAAGG - Intronic
1013640159 6:112067389-112067411 CAGTGACCTTACATGGAAATGGG + Intronic
1013991331 6:116257689-116257711 CTGTGTCCTCACATGCAAAAAGG + Intronic
1014019189 6:116568039-116568061 CAGAGTCCCCACATGCAAGAAGG + Intergenic
1014089605 6:117388822-117388844 CAGTTTCCACACCTGGAAATGGG - Intronic
1014294848 6:119605685-119605707 CTGTGTCCCCACATGGCTAAGGG + Intergenic
1014459084 6:121673861-121673883 CAGTGTTCCCACCTGTAAAATGG - Intergenic
1014756400 6:125305962-125305984 CAGTTTCCCCATCTGGAATGTGG - Intergenic
1014786943 6:125630385-125630407 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1015094630 6:129400136-129400158 CTGTGTCCTCACATGGTAAAAGG + Intronic
1015363070 6:132363669-132363691 CAGTGTGTTCATATGGAAAGTGG + Intronic
1017086504 6:150717624-150717646 CAGTGTCCCCACCTGGAGTGGGG - Intronic
1017512980 6:155130453-155130475 CAGTTTCCCCACCTGGAGAAGGG + Intronic
1018127021 6:160691644-160691666 CAGTGTCCTCACATGGCAGAAGG - Intergenic
1018149537 6:160925436-160925458 CAGTGTCCTCACATGGCAGAAGG + Intergenic
1018217290 6:161541191-161541213 CAGTGGCCATACATGGCAAGTGG - Intronic
1018828978 6:167427718-167427740 CAGTGTGCTGACATGGACAGTGG - Intergenic
1018907969 6:168086184-168086206 CAGTGTCCACACTGGGAATGTGG - Intergenic
1019533054 7:1513231-1513253 CAGTTCCCCCACCTGGAAAATGG + Intergenic
1019592304 7:1841777-1841799 CAGTGTCCCCACCTGTGAAATGG + Intronic
1022117505 7:27275172-27275194 CAGTTTCCCCATATGTAAAATGG - Intergenic
1022569446 7:31437286-31437308 CAGTTTTCTCACATGCAAAGTGG + Intergenic
1022610687 7:31868579-31868601 CAGGGTCCCCAAAAGCAAAGAGG + Intronic
1022767619 7:33431572-33431594 CTGTGTTCCCACATGGTAAAAGG - Intronic
1022846903 7:34219468-34219490 TGGTGTCCTCACAGGGAAAGAGG - Intergenic
1023197262 7:37655161-37655183 CAGTGTACTCACATGGTAAAAGG + Intergenic
1023313500 7:38911337-38911359 CAGTCTCTCCAAAAGGAAAGAGG - Intronic
1023338587 7:39195617-39195639 AAGTGGCCCCACATGGATACTGG - Intronic
1023553100 7:41389692-41389714 CAGTTTCCCCATCTGGAAAGTGG - Intergenic
1024210475 7:47199008-47199030 CTGTGTCCTCACATGGCAGGGGG + Intergenic
1024508754 7:50185774-50185796 CAGTTTCCCCACGTGTAAAATGG + Intergenic
1024919128 7:54538821-54538843 CATTGTACACATATGGAAAGAGG + Intergenic
1024944572 7:54795754-54795776 CAGTGCCCCCAGCTGGTAAGTGG + Intergenic
1025215434 7:57052048-57052070 CAGTGTTCTCACATGCAAAATGG - Intergenic
1025626181 7:63224475-63224497 CAGTGTTCTCACATGCAAACTGG - Intergenic
1025655941 7:63518654-63518676 CAGTGTTCTCACATGCAAAATGG + Intergenic
1026680503 7:72463062-72463084 CAGTGTCCACACCTGAAAAATGG - Intergenic
1028034867 7:85969434-85969456 AAATGTCCCTAAATGGAAAGGGG - Intergenic
1028331480 7:89600092-89600114 CTGTGTCCTCACATGGCAGGAGG - Intergenic
1028682575 7:93553631-93553653 CAATGTCCCCATTTGGAAAATGG + Intronic
1029597101 7:101543749-101543771 CAGTTTCCCCACATTGAAAATGG + Intronic
1029662345 7:101971091-101971113 CAGTCTCCCCAGATGGAAAATGG - Intronic
1029941608 7:104486506-104486528 CTGTGTCCTCACATGGTGAGAGG + Intronic
1030100694 7:105942541-105942563 CAGTTTCCCCACCTGTAAAATGG + Intronic
1030326953 7:108229936-108229958 CAGTTTCCTCATCTGGAAAGTGG + Intronic
1030708940 7:112726361-112726383 GAGTGGCCCCACATGGCATGTGG + Intergenic
1031602229 7:123724069-123724091 CAGTGTCTCCTCTTGGGAAGGGG - Intronic
1032196833 7:129794298-129794320 CAGTTTCCCCACCTGTGAAGTGG - Intergenic
1032889792 7:136182012-136182034 CAGTGTCCTCACATGGTGAAGGG + Intergenic
1034061842 7:148099169-148099191 CAGTTTCCCCACATGAAAAGTGG + Intronic
1034164052 7:149012349-149012371 CAGTGTCCACACCTGCCAAGAGG + Exonic
1034441921 7:151090046-151090068 CAGTGTCCCCATTTGGACTGAGG - Intronic
1034458065 7:151182246-151182268 CAGTGGGCACACATGGAAATGGG + Intronic
1034563383 7:151895493-151895515 CAGTGTCAGAACATGGACAGAGG - Intergenic
1035330822 7:158096326-158096348 CAGTTTCCCCACAAGGATGGAGG - Intronic
1035675699 8:1454246-1454268 CAGCGTCCCCACTTGGGAGGTGG + Intergenic
1036122144 8:6030196-6030218 CTGTGTCCTCACATGGTAGGAGG - Intergenic
1036387293 8:8293528-8293550 CAGTCTCCCCATCTGGAAAGCGG + Intergenic
1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG + Intergenic
1037590304 8:20306368-20306390 CAGTTTCCTCATCTGGAAAGTGG + Intergenic
1037590321 8:20306465-20306487 CAGTTTCCTCATCTGGAAAGTGG + Intergenic
1037606387 8:20441210-20441232 CAGTGTCCCCATCTGTAAAATGG - Intergenic
1037881926 8:22577813-22577835 CAGTTTCCCCATGTGGAAAATGG - Intergenic
1038036215 8:23689060-23689082 CTGTGTCCTCACATGGCAAGAGG + Intergenic
1038106418 8:24440139-24440161 CAATTTCCCCACCTGCAAAGTGG + Intergenic
1038437155 8:27544183-27544205 CAGATTCCCCACCTGAAAAGGGG + Exonic
1038673884 8:29606015-29606037 CAATTTGCTCACATGGAAAGTGG - Intergenic
1039766799 8:40637117-40637139 CTGTGTGCCCACATGGGAATGGG - Intronic
1039795366 8:40908482-40908504 CTGTGTCCTCACATGGAGGGAGG + Intergenic
1040049166 8:42995037-42995059 CTGTGTCCCCATATTGAATGTGG + Intronic
1040421273 8:47242481-47242503 CAGTTTCCCCATATGTAAACAGG + Intergenic
1040480059 8:47817245-47817267 CAGCGTCCCCACAGGGCAAGCGG + Intronic
1041257623 8:55992785-55992807 CTGTGTCCTCACATGGAAGAAGG + Intronic
1041460977 8:58111490-58111512 CAGTGTTCCCACATGGAACCAGG - Intronic
1041617686 8:59927446-59927468 CAGTTTCCCCATGTGGAAAAGGG + Intergenic
1041619016 8:59943493-59943515 CAGTTTCCCCACTTGGAAATTGG - Intergenic
1042058776 8:64794553-64794575 CTGTGTCCTCACATGGACAAAGG + Intronic
1043958189 8:86386948-86386970 CACTGTCCTCACATGGCAAAAGG + Intronic
1044290609 8:90464672-90464694 CAGTGTCCTCATATGTAAAATGG - Intergenic
1044695682 8:94920405-94920427 CAGTATCCTCACATGGCAGGAGG + Intronic
1045173398 8:99695745-99695767 CAGTGTCCCCACATGAAGGAAGG + Intronic
1046212423 8:111094700-111094722 CTGTGTCCTCACATGGCAAAAGG + Intergenic
1046650448 8:116831651-116831673 CTGTGTCCTCACATGGCATGGGG - Intronic
1047205744 8:122802020-122802042 CAGTTTCCCCACTTAGAAAGTGG + Intronic
1047364911 8:124202866-124202888 CAGTTTCCTCACATGTAAATGGG - Intergenic
1047670198 8:127137536-127137558 CTGTGTCCCCATATGCAAAATGG + Intergenic
1048444515 8:134483267-134483289 CAGTGTCCCCATTTGTAAAATGG - Intronic
1048565920 8:135597181-135597203 CAGTGTCCCCACAGGGCAGAAGG + Intronic
1048619183 8:136113125-136113147 CTGTGTCCTCACATGGTAATGGG - Intergenic
1049189916 8:141281403-141281425 CAGTTTCCCCACCTGTAAATGGG + Intronic
1049354762 8:142182235-142182257 CAGTCTCCCCATCTGGAAAGTGG + Intergenic
1049441024 8:142609893-142609915 CAGTGTCCCCACAAAGGCAGGGG + Intergenic
1049441053 8:142609997-142610019 CAGTGTCCCCACAAAGTCAGGGG + Intergenic
1049441068 8:142610049-142610071 CAGTGTCCCCACAAAGGCAGGGG + Intergenic
1049441083 8:142610101-142610123 CAGTGTCCCCACAAAGGCAGGGG + Intergenic
1049441098 8:142610153-142610175 CAGTGTCCCCACAAAGGCAGGGG + Intergenic
1051363565 9:16303777-16303799 CAGTGTTCTCCCATGGAATGTGG - Intergenic
1052021183 9:23527342-23527364 CAGTTTCCACACTTGGAAAAGGG - Intergenic
1052024435 9:23558871-23558893 CTGTGTCCCCACATGGTAAAAGG - Intergenic
1053044248 9:34900837-34900859 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1053203204 9:36166431-36166453 CAGCGTCCCCATCTGTAAAGTGG + Intergenic
1053287311 9:36858415-36858437 CAGTTTCCCCAAATGGACAATGG + Intronic
1054171938 9:61848486-61848508 TAGAGTCCCCAGAAGGAAAGCGG - Intergenic
1054446799 9:65377498-65377520 TAGAGTCCCCAGAAGGAAAGCGG - Intergenic
1054665597 9:67732326-67732348 TAGAGTCCCCAGAAGGAAAGCGG + Intergenic
1054916785 9:70501723-70501745 CTGTGCCCCCACATGGTAAAAGG - Intergenic
1054985554 9:71258242-71258264 CAGTTTCCCCATCTGAAAAGTGG - Intronic
1055689776 9:78816926-78816948 CCGTGTCCTCACATGGCAAGAGG + Intergenic
1055720271 9:79165408-79165430 CTGTTTCCCCATATGTAAAGGGG + Intergenic
1056047534 9:82734373-82734395 CACAGTCCCCACAGGGTAAGAGG + Intergenic
1056515375 9:87344550-87344572 CATTTTCCCCAGATGGAGAGTGG - Intergenic
1057307112 9:93918852-93918874 CAGTTTCACCACCTGGAAAAGGG + Intergenic
1057694178 9:97311802-97311824 CAGTTTCCCCAGGTGGGAAGTGG + Intronic
1058541263 9:106014874-106014896 CAGTGTCCTCACATGGTAGAAGG + Intergenic
1058712368 9:107691348-107691370 CAGTTTCCTCACATGGAAAATGG - Intergenic
1058834714 9:108850795-108850817 CAGTGTCCTCACCTGTAAAATGG + Intergenic
1059354557 9:113688546-113688568 CAGTATCCCCACCTGCAAAATGG - Intergenic
1059365385 9:113782820-113782842 CAGTTTCCCCACCTGTAAAATGG - Intergenic
1059466377 9:114471339-114471361 CAGTTTCCTCATCTGGAAAGTGG - Intronic
1059548379 9:115202205-115202227 CAGTGTTCCCAACTGTAAAGGGG - Intronic
1059656490 9:116362391-116362413 CAGTTTCCCCATATGTAAAATGG + Intronic
1059705665 9:116820962-116820984 CAGTGTGCCCACCTGTAAAATGG + Intronic
1059770188 9:117416566-117416588 CAGTTTCCTCACATGGAAAATGG - Intergenic
1060050503 9:120375181-120375203 CAGTTTCCTCACCTGTAAAGTGG - Intergenic
1060103859 9:120861665-120861687 CAGTGTCCCTACCTGGACAGTGG + Intronic
1060175338 9:121493439-121493461 CAGTTTCCCCACATGCAAAATGG + Intergenic
1060667786 9:125443302-125443324 CAGTGTCCCCACCTGTAAAGTGG - Intronic
1060861873 9:126961312-126961334 CAGTTTCCCCACATGCAATAGGG + Intronic
1061056157 9:128224099-128224121 CAGTGTCCCCAGTTGTAAAATGG - Intronic
1061188338 9:129068119-129068141 CAGTCTCCCCATCTGGAAAGTGG + Intronic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1061309085 9:129750762-129750784 CAGTGTCCTCACCTGTAAACGGG - Intronic
1061454204 9:130685400-130685422 CAGGTTCCTCACATGTAAAGTGG + Intergenic
1061565180 9:131434058-131434080 CAGTGTCCCCCCCTTGAAATAGG + Intronic
1061674916 9:132210237-132210259 CAGTTTCCCCACCTGTAAAATGG + Intronic
1061824115 9:133247235-133247257 CAGTCTCCCCACATGGACAATGG - Intergenic
1061883559 9:133579678-133579700 CAGTCTCCCCACCTGCAAAATGG - Intronic
1061908350 9:133710236-133710258 CAGTTTCGCCACCTGGAAAATGG - Intronic
1062097334 9:134710129-134710151 CAGTTTCCTCAGCTGGAAAGTGG + Intronic
1062360907 9:136187634-136187656 CAGGGTCCCCACATGCTCAGAGG + Intergenic
1062397020 9:136356692-136356714 CAGTGTCACCACATGACCAGGGG + Intronic
1062571294 9:137186591-137186613 CAGTGTCCCTACCTGGATAGAGG - Intronic
1186083698 X:5962785-5962807 CTGTGTCCTCACATGGAAAAAGG - Intronic
1186351314 X:8742459-8742481 CAGTGTTCTCAAATGGAAAATGG + Intergenic
1186462188 X:9757243-9757265 CTGTGTCCCCACATGGTAGAAGG + Intronic
1187337949 X:18397058-18397080 CAGAGTCCCAAGATGGCAAGGGG + Intergenic
1187529925 X:20086975-20086997 CAGTTTCCCCACCTGGAAAATGG - Intronic
1187606859 X:20894372-20894394 CAGTGTCCTCATCTGGAAAGTGG + Intergenic
1188054944 X:25530109-25530131 AAGTGTCTTCACATGCAAAGGGG - Intergenic
1188635311 X:32422703-32422725 CAGTGTCCCTAGATGGAATGAGG - Intronic
1188870912 X:35370645-35370667 CAGTGTCCCCACAGGGATTAAGG - Intergenic
1188911194 X:35849550-35849572 CTGTGTCCTCACATGGCAAAAGG - Intergenic
1189025561 X:37390136-37390158 CTGTGTCCTCACATGGCAAAAGG + Intronic
1189234083 X:39474454-39474476 CAGTTTCCCCACCTGCAAAATGG + Intergenic
1189470346 X:41309017-41309039 CAGTGCCCCCAGCAGGAAAGAGG - Intergenic
1191785761 X:64915804-64915826 CAGTGTCCTCATCTGGAAAATGG - Intronic
1192381697 X:70623726-70623748 CAGTTTCCCCAACTGTAAAGTGG - Intronic
1192453609 X:71259284-71259306 CAGTGTCCACAAATGTAAAATGG + Intergenic
1193505689 X:82340654-82340676 CAGTGTCCTCTCATAGGAAGAGG + Intergenic
1194163413 X:90483702-90483724 CCGTGGCCCTACATGGAAACAGG - Intergenic
1196286462 X:113886707-113886729 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1196314542 X:114208152-114208174 CTGTGCCCTCACATGGATAGAGG + Intergenic
1198630116 X:138627826-138627848 CAGTATGCCCACATAGAAATTGG + Intergenic
1198728173 X:139698988-139699010 CAGTCTCCTCACCTGGAATGTGG - Intronic
1198911825 X:141623511-141623533 CTGTGTCTTCACATGGAAGGTGG - Intronic
1199191206 X:144973501-144973523 CAGTGACCTCACCTAGAAAGAGG - Intergenic
1199208428 X:145176630-145176652 CAGTGTCACACCATGGAAAAGGG + Intergenic
1199234977 X:145481226-145481248 CTGTGTCCCCACATGGCAGAAGG + Intergenic
1199455547 X:148023970-148023992 CAGTTTCCCCATATGAAAAATGG + Intronic
1199713955 X:150492640-150492662 CAGTGTCCCCACCTACCAAGTGG + Intronic
1199945448 X:152662417-152662439 CAGTGTCCTCACATGGTGAAAGG + Intergenic
1200063590 X:153494640-153494662 CAGTGTCCCCATCTGGGCAGTGG + Intronic
1201511153 Y:14764698-14764720 CTGTGTCCCCACATGGGAAAAGG + Intronic
1201512514 Y:14780649-14780671 CTGTGTCCTCACATGGTAAAAGG - Intronic
1201539544 Y:15091145-15091167 CAGAGTCCCCAGGTTGAAAGAGG + Intergenic