ID: 903009030

View in Genome Browser
Species Human (GRCh38)
Location 1:20317520-20317542
Sequence GTGCCTGTCTTTGCTGGAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 208}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903009030_903009042 23 Left 903009030 1:20317520-20317542 CCTTTTCCAGCAAAGACAGGCAC 0: 1
1: 0
2: 1
3: 25
4: 208
Right 903009042 1:20317566-20317588 CTCCTGGAATAAGTTGTGCCTGG 0: 1
1: 0
2: 2
3: 8
4: 111
903009030_903009037 7 Left 903009030 1:20317520-20317542 CCTTTTCCAGCAAAGACAGGCAC 0: 1
1: 0
2: 1
3: 25
4: 208
Right 903009037 1:20317550-20317572 GTGCCTGGGCCCCGGGCTCCTGG 0: 1
1: 0
2: 6
3: 59
4: 548
903009030_903009036 0 Left 903009030 1:20317520-20317542 CCTTTTCCAGCAAAGACAGGCAC 0: 1
1: 0
2: 1
3: 25
4: 208
Right 903009036 1:20317543-20317565 TGCTTCGGTGCCTGGGCCCCGGG 0: 1
1: 0
2: 0
3: 9
4: 188
903009030_903009034 -7 Left 903009030 1:20317520-20317542 CCTTTTCCAGCAAAGACAGGCAC 0: 1
1: 0
2: 1
3: 25
4: 208
Right 903009034 1:20317536-20317558 CAGGCACTGCTTCGGTGCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 160
903009030_903009033 -8 Left 903009030 1:20317520-20317542 CCTTTTCCAGCAAAGACAGGCAC 0: 1
1: 0
2: 1
3: 25
4: 208
Right 903009033 1:20317535-20317557 ACAGGCACTGCTTCGGTGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 182
903009030_903009035 -1 Left 903009030 1:20317520-20317542 CCTTTTCCAGCAAAGACAGGCAC 0: 1
1: 0
2: 1
3: 25
4: 208
Right 903009035 1:20317542-20317564 CTGCTTCGGTGCCTGGGCCCCGG 0: 1
1: 0
2: 2
3: 22
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903009030 Original CRISPR GTGCCTGTCTTTGCTGGAAA AGG (reversed) Exonic
901625813 1:10624438-10624460 GTACCTGTCTCTGCTGCACAGGG + Intronic
903009030 1:20317520-20317542 GTGCCTGTCTTTGCTGGAAAAGG - Exonic
903095603 1:20970266-20970288 TTTCCAGTCTTTGCTGGAAAAGG - Intronic
903334685 1:22616989-22617011 CTGCCTGTCTTTCCTGGGAAGGG + Intergenic
905524108 1:38623650-38623672 GTGTCTGTATCTGGTGGAAATGG - Intergenic
906602301 1:47140835-47140857 GTGCCTGTCCTTATTGGATATGG + Exonic
907225457 1:52942185-52942207 GTGTCTTCCTTTCCTGGAAAAGG + Intronic
907526173 1:55055380-55055402 GTGCCTCTCTTTCATGGAAAGGG + Intronic
913313910 1:117533821-117533843 GTGCAGGGCTTTGCTGGAATTGG - Intergenic
915102736 1:153512283-153512305 ATGCCTGTTTTTGGGGGAAAGGG + Intergenic
915384767 1:155480195-155480217 CTGCCTCTCTTTTTTGGAAAAGG + Exonic
916086361 1:161272902-161272924 GTGCTTCTCTTTCCTGGAAGTGG + Intronic
916861985 1:168815946-168815968 GTGCTTGTCCTTGATGGAAGTGG - Intergenic
918296194 1:183159748-183159770 TTGCCTGTGTTTCCTGTAAATGG + Intergenic
919048992 1:192489120-192489142 GTGCATGTGTTTGCTTGATAGGG - Intergenic
920300936 1:204988527-204988549 TTTCCTGACTTTGCTGGAAAGGG - Intronic
920762890 1:208802840-208802862 GTGCCTGACTTTGTTGGCATTGG + Intergenic
921553460 1:216568096-216568118 GTGCCTGTCTTTGCTCACAGGGG - Exonic
921583282 1:216920448-216920470 GTGCCTGCATTTGCTGGCCATGG + Intronic
921837713 1:219795072-219795094 GTGCATGTTTTTCCTGGAATTGG + Intronic
922737419 1:227994988-227995010 GTGTTTGTCTTCTCTGGAAAGGG + Intergenic
923514504 1:234683287-234683309 GACCCTGTCTTTGCTGGGCATGG + Intergenic
1062952787 10:1517185-1517207 GTGCCTTCCTTTTTTGGAAAAGG + Intronic
1063963304 10:11325113-11325135 CTGCCTGTGTTTACTGGGAAAGG + Intronic
1064175126 10:13067942-13067964 TTGGATCTCTTTGCTGGAAAAGG + Intronic
1067690679 10:48499524-48499546 GTTCCTGGCTTTGATGGGAATGG - Intronic
1071142336 10:82523931-82523953 GTACCTGTTTTTGATGAAAAGGG - Intronic
1074936893 10:118190679-118190701 GGGCATGTCTTGGCTGGAAAAGG + Intergenic
1076383034 10:130038155-130038177 GTGCCTGTACCTGCTGGAAGAGG - Intergenic
1076673853 10:132137612-132137634 CTGCCTGTCTGTGCTGGCCAGGG - Intronic
1076724810 10:132408389-132408411 GTACCTGCCTTTCCTGGGAAGGG + Intronic
1077377255 11:2210869-2210891 GTGGGTGTCTTTGCATGAAACGG - Intergenic
1078287381 11:9970822-9970844 TTCCCTGTCTTTGCTAGATATGG - Intronic
1078413492 11:11147008-11147030 TTGCCTCACTGTGCTGGAAAGGG - Intergenic
1078853182 11:15182516-15182538 ATGCCTGACTTTGCAGGAAAAGG - Intronic
1083423002 11:62566554-62566576 GTTCCTGTCTTTGTTGGAATAGG + Intronic
1084702589 11:70796996-70797018 ATTCATGTCTTTTCTGGAAATGG - Intronic
1084785375 11:71438856-71438878 GTGCCTGTCATGGCTGGAGAGGG - Intronic
1084965454 11:72742033-72742055 CTGCCTGTGTTGGCTGGAGAGGG + Intronic
1085439392 11:76544564-76544586 GTGCTTGTTCTTGCTGGAGAGGG - Exonic
1085444869 11:76593803-76593825 TTGCCTGTTTTTGGTGGATAGGG - Intergenic
1088440458 11:109865318-109865340 GAGCTTGACTTTGATGGAAAAGG - Intergenic
1089156615 11:116407601-116407623 GTGCCTGCCTATGTTGGAGAGGG - Intergenic
1089682962 11:120129722-120129744 TTCCCTGGCTTTCCTGGAAAAGG + Intronic
1093073189 12:14728686-14728708 GTGTCTGTCTTGGCTGGGCATGG - Intergenic
1094113034 12:26881767-26881789 GTGCCTGCCTTTGCTGGGTTTGG - Intergenic
1095676344 12:44923398-44923420 GTGCCTTTCTTTCCTGCCAATGG - Intergenic
1097734010 12:63161722-63161744 GTGCATTTTTTTTCTGGAAAAGG + Intergenic
1098312524 12:69161906-69161928 GTATCTGTCTTTTCTGAAAATGG + Intergenic
1099191896 12:79569740-79569762 GAGACTGTCATTGCTGGAACTGG + Intergenic
1099995929 12:89778406-89778428 GTGCCTTTTTTTGGTGGGAAAGG - Intergenic
1100338603 12:93656481-93656503 GTCCCTGGCTTTGCTGTACAGGG + Intergenic
1102131243 12:110530402-110530424 ATCCCTGTCTTTGCTGGTGATGG - Intronic
1102333263 12:112054524-112054546 GGCCCTGACTTTGCTGGAAGAGG - Exonic
1103121711 12:118385796-118385818 GGGCCTTCCTTTACTGGAAAAGG - Intronic
1103488569 12:121298538-121298560 GTGCATGCATTTGCTGGAAATGG + Intergenic
1104506658 12:129338587-129338609 GTGCCTGCCTCTGCCTGAAAAGG + Intronic
1104753313 12:131253575-131253597 GTGCCTTTCTTGTCTGTAAAAGG + Intergenic
1104811547 12:131622762-131622784 GTGCCCGTCTTTGCTGGGTGAGG - Intergenic
1105274435 13:18906365-18906387 GTGACTGCCTTTGCTGAAACCGG - Intergenic
1105604141 13:21912952-21912974 GTGAGTGTGTTTGGTGGAAATGG + Intergenic
1105955284 13:25276108-25276130 GTGCGTGACTTGGCTGGAAAGGG + Intronic
1106644895 13:31623192-31623214 TTGCCTGTCTTTGAGGCAAAGGG + Intergenic
1106951075 13:34884806-34884828 GAGCCTGTCTCTGCATGAAAAGG - Intergenic
1109947052 13:69448536-69448558 CTGCCTGCCATTGCTGGAAATGG + Intergenic
1111250871 13:85599731-85599753 CTTCCTGTCTTTGGTGGACAAGG - Intergenic
1113215423 13:108035058-108035080 ATTCATGTCTTTTCTGGAAATGG + Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1117564801 14:56982594-56982616 GTGCCTCTTTTTGCAGGTAAAGG - Intergenic
1117990914 14:61432711-61432733 GTGGCAGGCTTTTCTGGAAATGG - Intronic
1120009152 14:79393332-79393354 GTCCTTGTCTATGCTGTAAATGG - Intronic
1121691680 14:95882417-95882439 GTGCTTCTCGTTGCTGGAAACGG - Intergenic
1122356287 14:101124808-101124830 GTGTCTGTGTGTGCTGGGAAGGG - Intergenic
1123675647 15:22708566-22708588 GTGCATGTTTTTCCTGGAATTGG - Intergenic
1123735340 15:23178392-23178414 GTGCATGTTTTTCCTGGAATTGG + Intergenic
1124285846 15:28399691-28399713 GTGCATGTTTTTCCTGGAATTGG + Intergenic
1124296856 15:28511973-28511995 GTGCATGTTTTTCCTGGAATTGG - Intergenic
1124327641 15:28781511-28781533 GTGCATGTTTTTCCTGGAATTGG - Intergenic
1129709874 15:77815301-77815323 GTGCCTGTGCTTGCTGGGCAGGG - Intronic
1129878583 15:78992844-78992866 GTGCCCGTCTGTGGAGGAAATGG - Intronic
1131052570 15:89358521-89358543 GTGCCAGTCTTAGGTGGAAGAGG + Intergenic
1131440687 15:92457285-92457307 GTGGCTGTCACTGTTGGAAAAGG - Intronic
1132633895 16:933566-933588 GGGCCGGTCTTTGCTGGTAAAGG - Intronic
1135808533 16:25566474-25566496 ATTCATGTCTTTTCTGGAAATGG - Intergenic
1136468743 16:30464135-30464157 GTGACTCTCTGTGCTGGAAGAGG - Intergenic
1142373927 16:89697265-89697287 GTGCTTCTCTTTGCTGGGGAGGG - Exonic
1143292171 17:5839689-5839711 TTGCCTCTCTTAGCTGGACATGG + Intronic
1145253684 17:21311093-21311115 GTGTTTGTCTGAGCTGGAAAGGG + Intronic
1145322902 17:21776868-21776890 GTGTTTGTCTGAGCTGGAAAGGG - Intergenic
1146056330 17:29583116-29583138 GTGGCTGGCGTAGCTGGAAACGG + Intronic
1147856463 17:43484115-43484137 GTACCTGTCTTTGGTGTCAAAGG + Exonic
1148525184 17:48325454-48325476 GTGCCTGTTTTTGGAGGTAAGGG + Intronic
1149248254 17:54737368-54737390 CTGCCTGTCTTTGGCAGAAAGGG - Intergenic
1149755088 17:59179830-59179852 GTGGGTCCCTTTGCTGGAAAAGG - Intronic
1150633492 17:66896974-66896996 GTGGATGTTTTTGCTGGAAACGG - Intergenic
1151262859 17:72930341-72930363 GAGCCTGTCTTTGCTAGTTATGG - Intronic
1154106648 18:11529239-11529261 GAGCCTTTCTATGCTGGAAGGGG + Intergenic
1154329321 18:13416384-13416406 GTTCCTGTTATTGTTGGAAAAGG - Intronic
1154466121 18:14643620-14643642 GTGACTGCCTTTGCTGAAACTGG - Intergenic
1155518920 18:26649811-26649833 TTGCCTCTCTCTCCTGGAAAAGG - Intronic
1156078090 18:33304889-33304911 GTTTATGTCTTTTCTGGAAATGG - Intronic
1157680404 18:49601157-49601179 ATGCCTGGCTTTGGGGGAAAGGG + Intergenic
1157680583 18:49602360-49602382 ATGCCTGGCTTTGGGGGAAAGGG - Intergenic
1158093298 18:53740835-53740857 ATATCTGTCCTTGCTGGAAAGGG + Intergenic
1158776096 18:60581711-60581733 GTTCCTGTGTTTGCTGAGAATGG + Intergenic
1159606868 18:70483899-70483921 GTTCTTGTATTTGCTGGTAATGG + Intergenic
1160742804 19:695203-695225 GTGGCTGCCTCTGCTGGAAATGG - Intronic
1163289912 19:16372625-16372647 CAGCCTGTCTTTCCTGGAAAAGG + Intronic
1165282585 19:34809806-34809828 ATGCCTTACATTGCTGGAAAAGG - Intergenic
1165684612 19:37808432-37808454 CTGCCTGACTGTGCAGGAAAGGG - Intronic
1167280257 19:48563330-48563352 GTTCCTGTCTTTGTGGGAACCGG - Intronic
926137446 2:10346823-10346845 GGGCCTGTCTGTGCTGGGGAGGG - Intronic
927415920 2:22880185-22880207 GTGCATGTCTTTGTAGGAATGGG + Intergenic
927717926 2:25364451-25364473 GTCCCTGTCTTTGCTCCCAAGGG - Intergenic
928293699 2:30062144-30062166 GTACCTGTCATTCTTGGAAAGGG - Intergenic
928975810 2:37085103-37085125 ATGCTTATCTTTGATGGAAATGG + Intronic
929556043 2:42926232-42926254 ATTCCTCTCTTGGCTGGAAAAGG - Intergenic
934697052 2:96407477-96407499 GTGCCTGTATTTGGTGAGAACGG - Intergenic
935637384 2:105259823-105259845 GTGCCTTTCCTTGTTGGCAAAGG + Intergenic
935919737 2:108000114-108000136 GTGACAGGCTTTGCTGGCAAGGG - Intronic
937113716 2:119387999-119388021 GTGACTGTCTCCACTGGAAATGG - Intergenic
937992437 2:127672171-127672193 GTCCCTGGCATTCCTGGAAATGG - Intronic
940882261 2:158958518-158958540 ATCCCTGTCATTGGTGGAAAAGG - Intergenic
940913830 2:159232947-159232969 GTGTCTGTTTTTACTGGCAACGG + Intergenic
942031433 2:171965403-171965425 TTTCCTTTCTTTACTGGAAAAGG + Exonic
943730528 2:191298875-191298897 TTGCCCCTCTTAGCTGGAAATGG + Intronic
944279268 2:197876183-197876205 GTGCCTGCCTCTGCAGGAGATGG + Intronic
945968792 2:216216543-216216565 GTTCCTGACTATGCTGGGAAAGG - Intergenic
946785032 2:223234798-223234820 GTGCCTGCCTTAGCTTTAAAAGG - Intergenic
947771385 2:232673080-232673102 GTGCCCAGCTTTGCTGGAGATGG - Intronic
1170063443 20:12285046-12285068 ATGCCTTTCTAAGCTGGAAAAGG - Intergenic
1173147823 20:40540343-40540365 GTGGCTGCCTTTTCTGGACAAGG + Intergenic
1174521320 20:51132808-51132830 GTGACTGTGTTTGCTGGATGGGG - Intergenic
1175026482 20:55907859-55907881 GTTTCTGTGTTTGTTGGAAAAGG - Intergenic
1175868606 20:62195829-62195851 GTGCTTGTCTGTGGAGGAAACGG + Exonic
1176808463 21:13514976-13514998 GTGACTGCCTTTGCTGAAACCGG + Intergenic
1178314303 21:31556432-31556454 TTGCCTGTTTTGGCTGGCAAAGG + Intronic
1178773056 21:35523689-35523711 GTGTCTGTGTTTGGTGGAAGGGG - Intronic
1181466348 22:23112608-23112630 GGCCCTGTCCTTGCTGGAGAAGG - Intronic
1182329319 22:29539361-29539383 GTGCCAGTGTTTGCTGGTGAGGG + Exonic
1184048309 22:41986150-41986172 GTGAGTGCCTCTGCTGGAAAGGG + Intronic
1184358294 22:43997068-43997090 GTGCCTCTCACTGCTGGCAAAGG - Intronic
949589704 3:5481511-5481533 ATGCCTGTCTTTGCTCCAGAGGG - Intergenic
949947551 3:9202510-9202532 GTGCAGGTCTTTGCTGGAGCAGG - Intronic
950205074 3:11073796-11073818 GTGATTGTCTTTGGTGGAAGTGG + Intergenic
951772423 3:26273382-26273404 TTGCCAGTCCTGGCTGGAAAGGG - Intergenic
951960507 3:28313880-28313902 GTGTCTGTGTTTTCCGGAAAAGG + Intronic
953023510 3:39131026-39131048 GTGCCTGCTTTTGCTGGCAAAGG + Exonic
958922826 3:100125295-100125317 GTGCTTCGTTTTGCTGGAAAGGG + Intronic
959477042 3:106823644-106823666 GTGTCTGCATGTGCTGGAAACGG + Intergenic
959644344 3:108680897-108680919 GTTCCAGTTTTTGCTGCAAATGG - Intronic
960618040 3:119613915-119613937 GTGCCTGTCACTATTGGAAAAGG - Intronic
960846285 3:122007138-122007160 GTGCCTGTCCTTGCTTGTGACGG - Exonic
961864880 3:129946347-129946369 ATCCATGTCTTTTCTGGAAATGG + Intergenic
961958189 3:130826030-130826052 GTTTCTCTCTTTGTTGGAAAGGG + Intergenic
965671515 3:171152696-171152718 TTTCCTGTCTTTTCTGGGAAGGG - Intronic
968779284 4:2567392-2567414 CTGGCAGTCTTTGCTGAAAAAGG - Intronic
969604006 4:8193204-8193226 GCGCCTGTTTCTGCTGGACAGGG + Intronic
971959677 4:33469951-33469973 TTTCCTGTGTTTGTTGGAAAGGG + Intergenic
973186902 4:47340529-47340551 ATGCCTGTCTGTGCAGGAAGTGG - Intronic
973879716 4:55257185-55257207 GTACCTGTCTTTGTTGGTCAAGG + Intergenic
974497594 4:62652389-62652411 GTGACTGTCCTTCCTTGAAATGG - Intergenic
975853344 4:78596247-78596269 GTGTCTGGCTTTTCTGGAAGTGG - Intronic
978537242 4:109775239-109775261 CTGCTTCCCTTTGCTGGAAAAGG - Intronic
980727675 4:136786416-136786438 GTACATGTCTCTGTTGGAAAGGG + Intergenic
981120654 4:141047360-141047382 CTGCCTGTCTCAGCTGCAAATGG - Intronic
981174362 4:141663755-141663777 ATGCCTGGCTTTGGTGAAAAGGG + Intronic
981429442 4:144643448-144643470 GTTCCACTCCTTGCTGGAAAGGG + Intergenic
982792276 4:159606855-159606877 GGGCCTATCTTAGCTGTAAAAGG - Intergenic
985652491 5:1113404-1113426 ATGACTGGCTTTACTGGAAATGG - Intergenic
985868853 5:2538191-2538213 GTGGCTGCCTTTTGTGGAAAAGG - Intergenic
986234193 5:5892538-5892560 GTGCCTTCCTTTTGTGGAAAAGG - Intergenic
986346952 5:6844684-6844706 ATGCCTGTCTTTGCTGAGGAGGG + Intergenic
989171353 5:38472711-38472733 GGGCCTGGCGATGCTGGAAAAGG + Intergenic
989858233 5:46328147-46328169 TTGGCTGTCTATGGTGGAAAAGG - Intergenic
993323741 5:86508042-86508064 GTCCCTCACTTTGCTGCAAATGG + Intergenic
994131104 5:96228605-96228627 TAGCCTGTCTTTGCGTGAAAAGG + Intergenic
995831447 5:116359966-116359988 GAGCCTGTCATTGCTGGGTAGGG + Intronic
997733922 5:136199797-136199819 GTGCCTGTCTTTGCAGGGCCAGG - Intergenic
997864542 5:137449464-137449486 CTGCCTCTCTTTGCTGGCCATGG - Intronic
998947301 5:147353402-147353424 CTTCCTGTTTTTGCTGGATAAGG - Intronic
999740377 5:154545587-154545609 CTGTCTCACTTTGCTGGAAAGGG + Intergenic
1000240989 5:159407920-159407942 GTGGCTGTCTTTGGAGAAAAGGG - Intergenic
1003733254 6:8849887-8849909 GTTCATGTCTTTTCTGGGAATGG - Intergenic
1007745842 6:44042520-44042542 GTGCCTGGCTCTGATGGAAAGGG - Intergenic
1010196990 6:73249645-73249667 TTGCCTGTCTCTGCTGGATGTGG + Intronic
1010960821 6:82143754-82143776 GTGTCTGTCTTTGATAGTAAAGG - Intergenic
1011740068 6:90350626-90350648 GTATCTGTATTTGCTTGAAATGG + Intergenic
1013918907 6:115376199-115376221 GTGCCTTTCTTTGCCACAAATGG - Intergenic
1018826384 6:167410492-167410514 GTGACTGTCTCTGCTGGATGGGG - Intergenic
1019607867 7:1919046-1919068 GTCCCTGTCCTTGCTGGGGAGGG - Intronic
1019738730 7:2662620-2662642 GTACCTGTCATGGATGGAAATGG - Exonic
1020435112 7:8153284-8153306 GTGCCTGTATTTAATGAAAATGG - Intronic
1020624364 7:10558992-10559014 GTGCCTGCCTTTCCTAAAAAGGG - Intergenic
1021399095 7:20188583-20188605 GTGCCTGTTTTTGCTGTAAAGGG - Intronic
1026383115 7:69819063-69819085 GTGCCTGAGTTTTGTGGAAATGG + Intronic
1029507028 7:100968801-100968823 GAGCCTGTCTATGCTGGCACCGG + Intergenic
1030625821 7:111845022-111845044 GTGCCTTTGTTTACTGTAAAAGG - Intronic
1031127760 7:117793688-117793710 GTGCCTTTCTGTGAAGGAAAAGG - Intronic
1031549240 7:123088076-123088098 GTCCCTGTGTTATCTGGAAATGG + Intergenic
1031926358 7:127642364-127642386 GGGCCTGCCTTCCCTGGAAAGGG + Intergenic
1033410305 7:141111422-141111444 GTGCCTGTATTTGCTGGCTCAGG - Intronic
1034992580 7:155557562-155557584 GTGCCTGAGTCTGCTGGGAAAGG - Intergenic
1035023845 7:155814219-155814241 GTGTCTGTTTTTACTGGGAACGG - Intergenic
1036481116 8:9140519-9140541 GTGCACGTCTGTGCTGGAAAGGG - Exonic
1037532043 8:19786528-19786550 GTGACTATCTTTGCTTGAAAAGG + Intergenic
1039102241 8:33953010-33953032 GTTCCTGTCTTTGCTGCGGATGG - Intergenic
1039961784 8:42254263-42254285 GTGACTATCTTTGGTAGAAATGG - Intergenic
1040340299 8:46437143-46437165 GTGCCTGTTTCTCCTGCAAAAGG - Intergenic
1041738762 8:61137700-61137722 GAGCCTGGCTATGTTGGAAAGGG - Intronic
1042715259 8:71765442-71765464 GTGCTTAGCTTGGCTGGAAATGG + Intergenic
1046163757 8:110401437-110401459 GAGCTTCTCTGTGCTGGAAAGGG + Intergenic
1049596392 8:143485807-143485829 GTGCCCTTCTTTACTGTAAAGGG - Intronic
1050165418 9:2760192-2760214 ATTCATGTCTTTTCTGGAAATGG - Intronic
1050209576 9:3238419-3238441 GTGCATGTGTTTGCTGGAATGGG + Intronic
1050555161 9:6783538-6783560 GTGTCTGTGTTTGGTGGAAAGGG + Intronic
1055154434 9:73042874-73042896 GTGCCTGTCTTGGTGGTAAATGG + Intronic
1055603887 9:77948410-77948432 CTCCCTTTCTTTGCTGGAAAAGG - Intronic
1060103885 9:120861769-120861791 GTGCCTGGCTTAGCTGTAATAGG + Intronic
1061958329 9:133975169-133975191 GTGCCTGCCTTTCCTAGTAAGGG - Intronic
1062235250 9:135504914-135504936 GTGCCCGTCTTTCCTGAAACTGG - Intergenic
1186111766 X:6265496-6265518 GTGCCTTTTTTGGATGGAAAAGG + Intergenic
1187924636 X:24238663-24238685 GTGCCTGTCTTTCGTGGCAATGG + Intergenic
1189021577 X:37347264-37347286 TTGCCTGTCTCTTCTGAAAACGG + Intergenic
1191568916 X:62581210-62581232 GTTACTGCCTTTGGTGGAAAAGG + Intergenic
1192081541 X:68052700-68052722 GCCCCTGCCTTTGCTGGCAAAGG + Intronic
1192153389 X:68725847-68725869 GTGGCTGTCTTTGCTGACAATGG + Intergenic
1195474783 X:105273405-105273427 ATGGCTGGCTTTGCAGGAAAGGG - Intronic
1195936607 X:110131524-110131546 GGTCCTGTCATTGGTGGAAAGGG + Intronic
1195954574 X:110316382-110316404 GCACTTGTCTTAGCTGGAAAAGG + Intronic
1197164466 X:123361387-123361409 GAGCCTGGCTTTGCAGGCAAGGG + Intronic
1198152132 X:133921874-133921896 GTGCCTGTCTCTCCTGGTTAGGG + Intronic
1198486931 X:137096631-137096653 GTGCCTGTCTCTCCTGCTAAAGG - Intergenic
1198771437 X:140135012-140135034 GTGCCAGTTTATGCTTGAAAAGG + Intergenic
1199849656 X:151716287-151716309 GTGCATGTGTGTGTTGGAAAAGG + Intronic