ID: 903009046

View in Genome Browser
Species Human (GRCh38)
Location 1:20317602-20317624
Sequence CACCGAAGTGTCCAACCCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903009041_903009046 18 Left 903009041 1:20317561-20317583 CCGGGCTCCTGGAATAAGTTGTG 0: 1
1: 0
2: 3
3: 13
4: 138
Right 903009046 1:20317602-20317624 CACCGAAGTGTCCAACCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 116
903009038_903009046 26 Left 903009038 1:20317553-20317575 CCTGGGCCCCGGGCTCCTGGAAT 0: 1
1: 0
2: 2
3: 23
4: 310
Right 903009046 1:20317602-20317624 CACCGAAGTGTCCAACCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 116
903009039_903009046 20 Left 903009039 1:20317559-20317581 CCCCGGGCTCCTGGAATAAGTTG 0: 1
1: 0
2: 0
3: 8
4: 114
Right 903009046 1:20317602-20317624 CACCGAAGTGTCCAACCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 116
903009044_903009046 -5 Left 903009044 1:20317584-20317606 CCTGGCGACTCTCCTGAACACCG 0: 1
1: 0
2: 0
3: 3
4: 68
Right 903009046 1:20317602-20317624 CACCGAAGTGTCCAACCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 116
903009043_903009046 11 Left 903009043 1:20317568-20317590 CCTGGAATAAGTTGTGCCTGGCG 0: 1
1: 0
2: 1
3: 6
4: 51
Right 903009046 1:20317602-20317624 CACCGAAGTGTCCAACCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 116
903009040_903009046 19 Left 903009040 1:20317560-20317582 CCCGGGCTCCTGGAATAAGTTGT 0: 1
1: 0
2: 1
3: 16
4: 175
Right 903009046 1:20317602-20317624 CACCGAAGTGTCCAACCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903009046 Original CRISPR CACCGAAGTGTCCAACCCCA TGG Exonic