ID: 903009255

View in Genome Browser
Species Human (GRCh38)
Location 1:20318718-20318740
Sequence AGCGGTACGGTGCCCCACAA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903009241_903009255 30 Left 903009241 1:20318665-20318687 CCTTGGCCAACAAGCACACCTTT 0: 1
1: 0
2: 0
3: 16
4: 151
Right 903009255 1:20318718-20318740 AGCGGTACGGTGCCCCACAACGG 0: 1
1: 0
2: 0
3: 0
4: 19
903009245_903009255 12 Left 903009245 1:20318683-20318705 CCTTTGACCGGCCTGTGGAGATC 0: 1
1: 0
2: 1
3: 1
4: 54
Right 903009255 1:20318718-20318740 AGCGGTACGGTGCCCCACAACGG 0: 1
1: 0
2: 0
3: 0
4: 19
903009249_903009255 -10 Left 903009249 1:20318705-20318727 CCTCATCCACCCCAGCGGTACGG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 903009255 1:20318718-20318740 AGCGGTACGGTGCCCCACAACGG 0: 1
1: 0
2: 0
3: 0
4: 19
903009246_903009255 5 Left 903009246 1:20318690-20318712 CCGGCCTGTGGAGATCCTCATCC 0: 1
1: 0
2: 1
3: 12
4: 162
Right 903009255 1:20318718-20318740 AGCGGTACGGTGCCCCACAACGG 0: 1
1: 0
2: 0
3: 0
4: 19
903009247_903009255 1 Left 903009247 1:20318694-20318716 CCTGTGGAGATCCTCATCCACCC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 903009255 1:20318718-20318740 AGCGGTACGGTGCCCCACAACGG 0: 1
1: 0
2: 0
3: 0
4: 19
903009242_903009255 24 Left 903009242 1:20318671-20318693 CCAACAAGCACACCTTTGACCGG 0: 1
1: 0
2: 1
3: 6
4: 39
Right 903009255 1:20318718-20318740 AGCGGTACGGTGCCCCACAACGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903009255 Original CRISPR AGCGGTACGGTGCCCCACAA CGG Exonic
903009255 1:20318718-20318740 AGCGGTACGGTGCCCCACAACGG + Exonic
903287459 1:22285895-22285917 AGCGGTGCGGTGACCCAGGAGGG - Intergenic
1066060306 10:31718066-31718088 AAAGGTACGGTTACCCACAAAGG - Intergenic
1067557280 10:47281769-47281791 AGCTGTACTGTGCACCAAAATGG + Intergenic
1073977187 10:109115389-109115411 AGTGGGACTGTGCCTCACAACGG + Intergenic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1094851948 12:34386226-34386248 TGCGGTAGAGTGCCCCACCACGG - Intergenic
1098844731 12:75521825-75521847 AAAGGTACGGTTACCCACAAAGG - Intergenic
1112050989 13:95643976-95643998 AGCGGCACGACGCCCCACGATGG - Intronic
1122959467 14:105087830-105087852 AGCGGGCCGGCGCCCCACTAAGG - Intergenic
1150888857 17:69121414-69121436 TGGGGTGAGGTGCCCCACAATGG + Intronic
948563325 2:238868095-238868117 ACCAGTGCAGTGCCCCACAAAGG + Intronic
1171204762 20:23270211-23270233 CGGGGGATGGTGCCCCACAAAGG + Intergenic
1175863326 20:62161651-62161673 AGGGGTGGGGTGCCCCACCATGG - Intronic
952513847 3:34084102-34084124 AAAGGTACGGTTACCCACAAAGG - Intergenic
954317052 3:49806882-49806904 AGAGGCAGGGTGCCTCACAAAGG + Intronic
977305399 4:95317936-95317958 TGCGGAATGGTGTCCCACAAAGG + Intronic
1010593230 6:77735025-77735047 AAAGGTACGGTTACCCACAAGGG - Intronic
1028395874 7:90368171-90368193 AAAGGTACGGTTACCCACAAAGG - Intronic
1062160540 9:135077222-135077244 AGTGGCAAGCTGCCCCACAAAGG + Intronic