ID: 903010732

View in Genome Browser
Species Human (GRCh38)
Location 1:20328321-20328343
Sequence CCTCCGTTTCACAAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903010726_903010732 0 Left 903010726 1:20328298-20328320 CCCAGGCCTGCCACTCACTGAAG 0: 1
1: 0
2: 1
3: 54
4: 285
Right 903010732 1:20328321-20328343 CCTCCGTTTCACAAGGATGATGG 0: 1
1: 0
2: 1
3: 2
4: 88
903010729_903010732 -10 Left 903010729 1:20328308-20328330 CCACTCACTGAAGCCTCCGTTTC 0: 1
1: 0
2: 21
3: 266
4: 2227
Right 903010732 1:20328321-20328343 CCTCCGTTTCACAAGGATGATGG 0: 1
1: 0
2: 1
3: 2
4: 88
903010728_903010732 -6 Left 903010728 1:20328304-20328326 CCTGCCACTCACTGAAGCCTCCG 0: 1
1: 0
2: 0
3: 22
4: 211
Right 903010732 1:20328321-20328343 CCTCCGTTTCACAAGGATGATGG 0: 1
1: 0
2: 1
3: 2
4: 88
903010727_903010732 -1 Left 903010727 1:20328299-20328321 CCAGGCCTGCCACTCACTGAAGC 0: 1
1: 0
2: 4
3: 39
4: 280
Right 903010732 1:20328321-20328343 CCTCCGTTTCACAAGGATGATGG 0: 1
1: 0
2: 1
3: 2
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903010732 Original CRISPR CCTCCGTTTCACAAGGATGA TGG Intronic
903010732 1:20328321-20328343 CCTCCGTTTCACAAGGATGATGG + Intronic
921991546 1:221372630-221372652 CCTCCCTTTCACCTGGCTGAGGG - Intergenic
1063056240 10:2507453-2507475 CCTCCCCTTCAGAGGGATGATGG - Intergenic
1075845928 10:125544954-125544976 GCTCCGTCTCACAGGTATGAGGG + Intergenic
1076463674 10:130663920-130663942 CTTCCTTTTCACAAGAATGATGG - Intergenic
1079544818 11:21620554-21620576 CCCCAGTTTCACATGGCTGAGGG - Intergenic
1086424723 11:86672224-86672246 CCTCTTTTTCACAGGGATGGGGG - Intronic
1091843110 12:3634340-3634362 CCTCAGTTACCCAAGGAAGATGG - Intronic
1093211949 12:16318325-16318347 CCTCAGTTCCACAAGGTGGAAGG - Intergenic
1096844156 12:54396224-54396246 CCTCCTTTTCAGTAGAATGAGGG + Exonic
1099401938 12:82211134-82211156 CCTCCCTGTTACATGGATGAAGG + Intergenic
1102152744 12:110699907-110699929 CCTCCGTTCCACAAGGTGGCAGG + Intronic
1104926449 12:132316483-132316505 TCTCCGTTTCCCAGGGAGGAAGG - Intronic
1108322452 13:49301928-49301950 CCTCCATTCCACACGGATGCTGG - Intergenic
1110701588 13:78554907-78554929 CCTCTGTTCCCCAAGGATCAGGG - Intergenic
1118798929 14:69171584-69171606 CATCTGCTTCACAAGGATCATGG + Intergenic
1123922648 15:25081353-25081375 CCTCAGTTTGACGAGGATGACGG - Intergenic
1123922867 15:25082834-25082856 CCTCAGTTCGACGAGGATGACGG - Intergenic
1123922980 15:25083654-25083676 CCTCAGTTCGACGAGGATGACGG - Intergenic
1123923232 15:25085451-25085473 CCTCAGTTCGACGAGGATGACGG - Intergenic
1123923388 15:25086593-25086615 CCTCAGTTCGACGAGGATGACGG - Intergenic
1123923725 15:25088870-25088892 CCTCAGTTCGACGAGGATGACGG - Intergenic
1123923887 15:25089989-25090011 CCTCAGTTCGACGAGGATGACGG - Intergenic
1123924153 15:25091852-25091874 CCTCAGTTTGACGAGGACGACGG - Intergenic
1124331323 15:28819097-28819119 CCTCCTTTTCTCATGGAAGAAGG + Intergenic
1127989249 15:64099534-64099556 CCTCAGCTTCACAAGTATGCGGG - Intronic
1130153260 15:81327836-81327858 GCTCCTTTTCACAGCGATGATGG + Intergenic
1134002365 16:10792746-10792768 AGCCCGTTTCAGAAGGATGATGG - Intronic
1134243105 16:12520249-12520271 CCTCCTCTTCACAAGGCAGATGG + Intronic
1135483169 16:22840279-22840301 CCTCCCTGACACAAGTATGAAGG - Intronic
1137903335 16:52293189-52293211 CCTCATGTTCACAAGGAAGATGG - Intergenic
1137992866 16:53177773-53177795 CTTCCATTTATCAAGGATGAAGG - Intronic
1140692051 16:77493931-77493953 CCTTCGTTCCAAAAGAATGAGGG - Intergenic
1143127551 17:4653221-4653243 CCTCCGCTTCACCCAGATGATGG - Intergenic
1144421946 17:15106954-15106976 CCGCCGTTTCCAAAGGATGGGGG - Intergenic
1144913124 17:18699560-18699582 CCTGCCTTTCTGAAGGATGAGGG + Intronic
1151942232 17:77300046-77300068 CTTCCGCTTCACAGGGAGGATGG + Intronic
1157623778 18:49031720-49031742 GTCCCGTTTCACAAGGAAGACGG + Intergenic
1163086077 19:14980198-14980220 CCTCCGCTAAACAAGGAAGATGG + Intronic
1164468004 19:28504748-28504770 ACTCACTTACACAAGGATGAAGG - Intergenic
939355088 2:141091303-141091325 CTTACGTTTCAAAAGGATCAAGG + Intronic
944564683 2:200977349-200977371 CCTCTGTTTCTTGAGGATGAAGG + Exonic
946536837 2:220639552-220639574 CCTCAATTTCAAAAGGATGGGGG - Intergenic
946706033 2:222459797-222459819 TCTCAGTTTTACAAGGAGGATGG - Intronic
1171135992 20:22694843-22694865 CCATCGTTTCACAAGGATCTTGG + Intergenic
1171406096 20:24913306-24913328 CCTCAGTTGAAGAAGGATGAGGG + Intergenic
1172206741 20:33167783-33167805 CCTCAGTTTCCAAATGATGACGG + Intronic
1175695186 20:61097905-61097927 CCTCTGTTTCTCCAGGGTGAAGG - Intergenic
1176061910 20:63176165-63176187 CCCCCGTTTCATTAGGGTGAGGG + Intergenic
1181683106 22:24509568-24509590 CCTCCTTGTCACTAGGAGGAGGG + Intronic
1185346602 22:50313306-50313328 CCCCAGTTTCACAAACATGATGG + Intronic
954127248 3:48538841-48538863 CCCCTGTACCACAAGGATGAGGG - Intronic
954144993 3:48630122-48630144 CTTCAGGTTCACAATGATGATGG + Exonic
964821573 3:160776283-160776305 CTTCTGTTTCCCATGGATGAAGG - Intronic
966946267 3:184779155-184779177 GCTCCGTGGCACAAAGATGACGG - Intergenic
976838248 4:89400937-89400959 CCTCCCATTCACCAGGATAATGG - Intergenic
977552057 4:98452507-98452529 CATGCTTTTCATAAGGATGATGG - Intergenic
982602574 4:157470253-157470275 TCCCTGTTTCACATGGATGAAGG + Intergenic
985153176 4:186964801-186964823 CCACCATTTCACATGGAAGAGGG + Intergenic
985154099 4:186970181-186970203 CCACCATTTCACATGGAAGAGGG + Intergenic
985154310 4:186971411-186971433 CCACCATTTCACATGGAAGAGGG + Intergenic
986833368 5:11606997-11607019 TCTCCTTTTTACAAGGATGCTGG - Intronic
990792329 5:59495969-59495991 CCACCTTATCACAAGGACGAGGG + Intronic
993414844 5:87614287-87614309 CCTCCTTTGCAAAAGGATGTAGG + Intergenic
999045159 5:148459328-148459350 CCTCCCTGTCAGAAGCATGAGGG - Intronic
999112099 5:149130459-149130481 GCTCCCTTTCACAAGGATGAGGG + Intergenic
1000161145 5:158598762-158598784 CCACCATTCCACAAGGATGGAGG - Intergenic
1003287689 6:4748966-4748988 CCTTCGTTTCACACAGAGGATGG + Intronic
1011068140 6:83351414-83351436 CCTCCCTTAGACAAGGAAGATGG + Intronic
1011724581 6:90197220-90197242 CCTCTGTATCACAAAAATGAAGG + Intronic
1020081109 7:5286101-5286123 CCTCAGTTTCCCCAGTATGAAGG - Intronic
1026664665 7:72331969-72331991 CCTGCGTTTGCCAAGGATAATGG + Intronic
1027959417 7:84925506-84925528 ACTCAGATTCACAAGGATGGGGG + Intergenic
1031430475 7:121662339-121662361 TCTCCATTTCAGAAGCATGATGG + Intergenic
1038247444 8:25872102-25872124 CTTCTGTTTCACAAAAATGAAGG + Intronic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1040531483 8:48269926-48269948 CCTCCCTTGCACAAGCTTGATGG + Intergenic
1041865286 8:62566032-62566054 CCTCTGCCTTACAAGGATGATGG - Intronic
1044429905 8:92096165-92096187 CCTCCTTATCACAATGATGCTGG - Intronic
1046742633 8:117845264-117845286 CCTGTCTTTCACAGGGATGAGGG + Intronic
1049065673 8:140311885-140311907 CATCCCTTTCACAAGGAGGGAGG + Intronic
1049573647 8:143380835-143380857 CCTCCCTTTCTCCAGGACGAAGG - Intronic
1050981423 9:12020624-12020646 CCTCCATGGCACAAGTATGAAGG - Intergenic
1061943258 9:133894224-133894246 CCACCCTTTCCCAAGGATGGGGG + Intronic
1187253091 X:17617052-17617074 CCCCAGTTTCACAAAGCTGATGG - Intronic
1189663697 X:43330638-43330660 CCTCAGTTTCAAAACGAGGAGGG - Intergenic
1191896428 X:65998164-65998186 CCTCAGTTGCTCAAGAATGACGG - Intergenic
1192141578 X:68651163-68651185 CCTCCTATGCACAAGCATGAGGG + Intronic
1193385875 X:80871327-80871349 CCTCCAGTTCAGAAGGATCATGG + Intergenic
1195067128 X:101247835-101247857 CATCAGTTTCAAAAAGATGATGG - Intronic
1200624069 Y:5490682-5490704 CCTCCAATTCAGAAGGAGGAGGG - Intronic
1200798599 Y:7364218-7364240 CCTCCTCTTCACCAGGAAGAAGG + Intergenic