ID: 903010732

View in Genome Browser
Species Human (GRCh38)
Location 1:20328321-20328343
Sequence CCTCCGTTTCACAAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903010727_903010732 -1 Left 903010727 1:20328299-20328321 CCAGGCCTGCCACTCACTGAAGC 0: 1
1: 0
2: 4
3: 39
4: 280
Right 903010732 1:20328321-20328343 CCTCCGTTTCACAAGGATGATGG 0: 1
1: 0
2: 1
3: 2
4: 88
903010729_903010732 -10 Left 903010729 1:20328308-20328330 CCACTCACTGAAGCCTCCGTTTC 0: 1
1: 0
2: 21
3: 266
4: 2227
Right 903010732 1:20328321-20328343 CCTCCGTTTCACAAGGATGATGG 0: 1
1: 0
2: 1
3: 2
4: 88
903010726_903010732 0 Left 903010726 1:20328298-20328320 CCCAGGCCTGCCACTCACTGAAG 0: 1
1: 0
2: 1
3: 54
4: 285
Right 903010732 1:20328321-20328343 CCTCCGTTTCACAAGGATGATGG 0: 1
1: 0
2: 1
3: 2
4: 88
903010728_903010732 -6 Left 903010728 1:20328304-20328326 CCTGCCACTCACTGAAGCCTCCG 0: 1
1: 0
2: 0
3: 22
4: 211
Right 903010732 1:20328321-20328343 CCTCCGTTTCACAAGGATGATGG 0: 1
1: 0
2: 1
3: 2
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903010732 Original CRISPR CCTCCGTTTCACAAGGATGA TGG Intronic