ID: 903011361

View in Genome Browser
Species Human (GRCh38)
Location 1:20332882-20332904
Sequence ACCCCACCAGCCGTTCTCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903011361 Original CRISPR ACCCCACCAGCCGTTCTCCA GGG (reversed) Exonic
900096226 1:941205-941227 AGCCCACCTGCCCTCCTCCACGG + Exonic
901772710 1:11538724-11538746 GCCCCACCAGCCTGTCCCCAGGG + Intergenic
902875397 1:19337849-19337871 ACCCAGCGAGCCGTTCCCCATGG - Intergenic
903011361 1:20332882-20332904 ACCCCACCAGCCGTTCTCCAGGG - Exonic
906060176 1:42943432-42943454 ACCACACCAGTCTTTCTCCCAGG + Intronic
907620070 1:55968521-55968543 ACCCCACCAGCTCTGCTCCAGGG + Intergenic
911240485 1:95459999-95460021 ACCCCAACAACAGTACTCCATGG + Intergenic
922499565 1:226086466-226086488 AGCCCACCAGCCCCGCTCCAGGG - Intergenic
924689998 1:246338789-246338811 ACCACACCAGTAGTTCTCAATGG + Intronic
1062973733 10:1667998-1668020 ACCCAACCAGCCTTTAGCCAAGG - Intronic
1063957812 10:11282368-11282390 ACACCATGAGCCATTCTCCAAGG - Intronic
1067223354 10:44359713-44359735 ACCCCACCAGCTGTCCTGCCAGG - Intergenic
1069853778 10:71427413-71427435 ACGCCACCAGCCAGTCACCAAGG - Intronic
1073048355 10:100653196-100653218 ACCCCAGCCCCAGTTCTCCATGG + Intergenic
1073320838 10:102615489-102615511 CCCCCAGCAGGCGTCCTCCAGGG + Intronic
1075787449 10:125059690-125059712 ACCCCAGAAGCCATGCTCCAAGG + Intronic
1075905528 10:126078394-126078416 TCCTCTCCAGCCGTTCTCCAAGG + Intronic
1076751309 10:132544807-132544829 ACACCGCCGGCCGTTCTCAAAGG - Intronic
1079557205 11:21774338-21774360 ACACCAACAGGAGTTCTCCAGGG - Intergenic
1080224247 11:29942943-29942965 GCCCCACCAGCCTTGCTCCAGGG + Intergenic
1082833875 11:57638529-57638551 ACCCCGCCAGCCCCTCTCCCGGG - Intergenic
1089366729 11:117925132-117925154 TCCCCACCAGCTGGTCTGCAAGG - Intronic
1091223859 11:133946350-133946372 CCCCCACCAGCTGCCCTCCATGG + Intronic
1092533706 12:9366676-9366698 TCCCCACCAGCAGCTCTTCATGG + Intergenic
1092671760 12:10869730-10869752 ACCCCAGAAGTCCTTCTCCAAGG + Intronic
1092702930 12:11253182-11253204 ACCCCAAAAGGCCTTCTCCAAGG + Intergenic
1093404986 12:18793332-18793354 AGCCCACGAGGCATTCTCCAAGG - Intergenic
1095870806 12:47026018-47026040 ACCCCAGCAGCCTATCTTCAGGG + Intergenic
1101666614 12:106822294-106822316 ACCCCACCAGTTGCTCTACAGGG - Intronic
1103704247 12:122862713-122862735 ACCCCTCCTGCCGCTCTCCTTGG - Exonic
1105728978 13:23192681-23192703 ACCCTACCAGCCGGGCGCCATGG - Intronic
1112339570 13:98542031-98542053 TCTCCACCCGCTGTTCTCCAAGG + Intronic
1113962171 13:114132286-114132308 GCCGGACCAGCCGTTCTCCGGGG + Intronic
1118560807 14:67080031-67080053 ACCCCACCAGCTGTGCACAAGGG + Intronic
1121004773 14:90483106-90483128 CCTCCTCCAGCCCTTCTCCAGGG - Intergenic
1121367656 14:93329410-93329432 ACCCCACCAGCAGTGCACAAGGG - Intronic
1124010462 15:25834530-25834552 TTCCCACCAGCAGTTCTCCGAGG - Intronic
1124533321 15:30524207-30524229 GCCCCACCAGCCTCTGTCCAGGG + Intergenic
1124765336 15:32483438-32483460 GCCCCACCAGCCTCTGTCCAGGG - Intergenic
1129656107 15:77526738-77526760 AACCCCCCAGCTTTTCTCCAGGG - Intergenic
1137597647 16:49735470-49735492 ACCCCACCTGCCCTTCTGCAGGG + Intronic
1139406327 16:66721009-66721031 CCCCCACCAGCCTTAGTCCAGGG - Exonic
1139691357 16:68643976-68643998 ACCCCACAAGCCCTTCCCCACGG - Intronic
1140275460 16:73504782-73504804 ACTCCAGCAGCCAATCTCCACGG - Intergenic
1142319241 16:89370419-89370441 AGCCCTCCTGCCGTTATCCAGGG + Intronic
1142371952 16:89687330-89687352 CCCCCACCAGCCGTGCACCTGGG - Intronic
1142566016 17:840906-840928 CCCCCACAAGCCTTTCTCCAAGG + Intronic
1143765622 17:9135716-9135738 GCCCCACCAGGCCTACTCCAGGG - Intronic
1144306005 17:13970164-13970186 ACCCCACCACCTCTTCTGCACGG + Intergenic
1144623664 17:16833672-16833694 ACCCCACCGGCCCTTCCCCAAGG + Intergenic
1145149467 17:20505342-20505364 ACCCCACCGGCCCTTCCCCAAGG + Intergenic
1147577997 17:41613604-41613626 ACCCCACCGGCCCTTCCCCGAGG + Intronic
1149618939 17:58027042-58027064 ACCACACCTGCAGTTTTCCATGG - Intergenic
1150282824 17:63939325-63939347 GACACACCAGCCGTACTCCATGG + Exonic
1150728973 17:67675291-67675313 ACACCTCCAGCCCTTCCCCATGG - Intronic
1150855810 17:68751394-68751416 CACCCAACAGCCATTCTCCAAGG - Intergenic
1151619948 17:75239489-75239511 GCCCCTCCTGCCCTTCTCCACGG - Exonic
1152349322 17:79775148-79775170 CCACCACCAGCCGGTCTGCATGG - Intergenic
1161209286 19:3057795-3057817 CCCCCACCCTCCGTTATCCAGGG + Intronic
1161253879 19:3295619-3295641 CCCCCACCACCAATTCTCCAGGG + Intronic
1161453306 19:4358371-4358393 TCCCCACCTGCTGTTCTCTAAGG + Intronic
1161516946 19:4701959-4701981 ACCTCACCAGCCATGCCCCAGGG + Intronic
1162717357 19:12642461-12642483 ACGGCACCAGTCGGTCTCCAAGG + Intergenic
1163184288 19:15626945-15626967 ACCACACTATCCATTCTCCAGGG + Intronic
1165013003 19:32862366-32862388 GCCCCACGAGCCCATCTCCAAGG - Intronic
1166046671 19:40234275-40234297 ACCCTCCCATCCATTCTCCACGG + Intronic
926617571 2:15012574-15012596 ACCCAAACAGCTTTTCTCCAAGG + Intergenic
930872945 2:56185361-56185383 GCCCCGCCAGCCGCTCTCCCTGG - Intronic
932338808 2:70946761-70946783 ACCAGACCTGCCATTCTCCATGG + Intronic
932570279 2:72934814-72934836 ACCTGCCCAGCGGTTCTCCAAGG - Exonic
934759315 2:96844693-96844715 CCCCTACCAGACGCTCTCCAGGG + Intronic
935377256 2:102411946-102411968 CACCCACCAGCCGTTGACCATGG + Intergenic
937873033 2:126799319-126799341 ACCCCTCCATCTTTTCTCCAAGG + Intergenic
944597142 2:201271355-201271377 ACCACACCAGCCTCTTTCCAAGG + Intronic
1169327556 20:4687283-4687305 GCCCCACCCTCTGTTCTCCAGGG + Intronic
1172112130 20:32553202-32553224 AGGCCACCAGCCTTTCTCCCTGG + Intronic
1172636626 20:36414393-36414415 CCCCCACCAGCTCTTCTGCAAGG + Intronic
1173993012 20:47317435-47317457 ACAGCACATGCCGTTCTCCAGGG + Intronic
1174072022 20:47906039-47906061 CCCCCAACAGCTGTCCTCCAGGG + Intergenic
1176040590 20:63063697-63063719 CCCCCACCAGCCGTGCACGAGGG + Intergenic
1178437961 21:32575985-32576007 AGCCCACATGCCGGTCTCCAGGG - Intergenic
1179818582 21:43923443-43923465 TCCCCACAAGCAGTGCTCCAGGG + Intronic
1180790965 22:18575345-18575367 GCCCCGCCAGCTCTTCTCCAGGG + Intergenic
1181230770 22:21419969-21419991 GCCCCGCCAGCTCTTCTCCAGGG - Intronic
1181247877 22:21514900-21514922 GCCCCGCCAGCTCTTCTCCAGGG + Intergenic
1181505521 22:23353784-23353806 ATCCCACCAGCCAGGCTCCAAGG - Intergenic
1182624263 22:31634474-31634496 GCCCCACCAGCAGCTCCCCAAGG + Intronic
1182877171 22:33702315-33702337 ACCACACCTACCATTCTCCAAGG + Intronic
1183654437 22:39176633-39176655 AGCCCACCTACCGTTCCCCAGGG + Intergenic
1183702003 22:39456412-39456434 TGCCCACCAGCGGTTCTCCGAGG - Intergenic
1185083057 22:48720395-48720417 ACCCCTCCAGCGATTCTCGAGGG - Intronic
949549093 3:5097416-5097438 ATCCCACCAGAAGGTCTCCATGG - Intergenic
952427302 3:33188615-33188637 TCCACAGCAGCAGTTCTCCAAGG - Intronic
954364720 3:50139721-50139743 TCCTCACCAGCCTTTCTCCCAGG - Intergenic
959342521 3:105149117-105149139 ACCCTAGCAGAGGTTCTCCATGG + Intergenic
959897993 3:111627194-111627216 ACCCCACCAGCTGTATTCTATGG + Intronic
965733023 3:171792473-171792495 ACCACACCAGCTGATCTGCAAGG + Intronic
969131795 4:4995593-4995615 CCCACACCAGCCCTTCTCCCAGG + Intergenic
969423180 4:7108942-7108964 AGCCCACCAGCCTCTCTCCCTGG + Intergenic
973537357 4:51896765-51896787 TTCCCACCAGTCCTTCTCCATGG + Intronic
977824232 4:101510938-101510960 ATCCCACCATCCATTCCCCAGGG - Intronic
980564345 4:134519014-134519036 ACCACACCTGCTGTTCTCCTTGG + Intergenic
980634278 4:135478494-135478516 AGACCACCATCTGTTCTCCAGGG + Intergenic
981990385 4:150912612-150912634 CCCCCACCACCCGTGGTCCATGG + Intronic
984947791 4:184983387-184983409 AGCCCTCCAGCCACTCTCCAAGG + Intergenic
985786955 5:1901301-1901323 CCACCACCAGCCGTTCCCAAGGG + Intergenic
989731655 5:44656472-44656494 GCCCCAGCAGATGTTCTCCATGG - Intergenic
990890742 5:60647099-60647121 ACCCCAGCAGCCCTGGTCCATGG + Intronic
991918627 5:71631331-71631353 ACCCGCCCAGGCCTTCTCCATGG - Intronic
994060942 5:95475953-95475975 ACCTCACCAGCTCTGCTCCAGGG + Intronic
998372913 5:141672646-141672668 ACCCCACCAGGCCTTCTCTCTGG - Exonic
999701608 5:154233616-154233638 CCCCCACCAGCCGCCCACCATGG + Intronic
1003344506 6:5254793-5254815 ACCCCACCAGCTGTGCTCTCAGG + Intronic
1005397725 6:25400533-25400555 CCCCCACCAGCTGTGCTTCATGG + Intronic
1005813143 6:29531236-29531258 ACCTCACCAGCCCTGCTCCCTGG + Intergenic
1013658909 6:112274226-112274248 AGCCCACCACCCATTCTGCATGG - Intergenic
1014228549 6:118875859-118875881 AACCCAGCAGCTGTGCTCCATGG + Intronic
1015482659 6:133730294-133730316 AACCCACCAGCCTCTCTCCATGG - Intergenic
1016055939 6:139577911-139577933 ACCCCATCAGCAGTTCTGTATGG - Intergenic
1018023852 6:159789250-159789272 AGCCCACCCGCCGTTCTCTGGGG - Intronic
1018795048 6:167179326-167179348 AGCCCACATGCCGGTCTCCAGGG + Intronic
1018821270 6:167375736-167375758 AGCCCACATGCCGGTCTCCAGGG - Intronic
1021534834 7:21691410-21691432 ACCCCTCCTGCCGCTCTCCTTGG + Intronic
1023394194 7:39737214-39737236 AGCCCACCTGCTGTTCTCCAGGG + Intergenic
1027628023 7:80567588-80567610 ACTCCACCAATCTTTCTCCAAGG - Intronic
1029551270 7:101238293-101238315 GCCCCACCATCCATTCACCAGGG + Exonic
1029575410 7:101400267-101400289 AGCCCACCAGGCCTTCTGCAAGG - Intronic
1035771401 8:2149996-2150018 ACCACACCAGCCTCACTCCATGG + Intronic
1037680884 8:21096576-21096598 CCCCCACCCCCCGTTCTCCAGGG + Intergenic
1038001912 8:23399221-23399243 ACCACAAAAGCCTTTCTCCAGGG + Intronic
1038014247 8:23499770-23499792 CCCCCTCCAGCAGTTCTCCTGGG - Intergenic
1039770179 8:40678420-40678442 ATCCCACCAGCCTTTGCCCAAGG + Intronic
1046004106 8:108458389-108458411 ACCCTAGCAGAGGTTCTCCATGG + Intronic
1048995868 8:139793417-139793439 ACCCCAGCAGCATTTCTTCAAGG + Intronic
1049251054 8:141589160-141589182 AGCCCACCAGGTGTTCACCAAGG + Intergenic
1053250102 9:36567170-36567192 ACCCAACTGGCCTTTCTCCACGG + Intergenic
1058119500 9:101123420-101123442 ACCCCAACAACCCCTCTCCATGG - Intronic
1058888776 9:109343152-109343174 ATGCCACCAGCTGTTCTCCTTGG - Intergenic
1059451822 9:114376014-114376036 ACCCCACCAGCCTCTATCCCAGG + Intronic
1059451844 9:114376075-114376097 ACCCCACCAGCCTCTATCCCAGG + Intronic
1059451868 9:114376136-114376158 ACCCCACCAGCCTCTATCCCAGG + Intronic
1061882351 9:133574655-133574677 CCCCCACGTGCCGTTTTCCAGGG - Intronic
1061895165 9:133643340-133643362 TCCCCAGCAGCCCTCCTCCATGG - Intronic
1192822059 X:74656369-74656391 ACCCCATCAGCCCTTCTCACTGG - Intergenic
1194830756 X:98619937-98619959 ACCCTAGCAGAGGTTCTCCATGG + Intergenic
1195938519 X:110147429-110147451 ACCCCACCGGCAGCTCTGCATGG + Intronic
1198032104 X:132763186-132763208 ACCCCACAAGCCACTCTTCAAGG - Intronic
1199672157 X:150156182-150156204 CCCCCACCAGCCCCTCTCCAGGG - Intergenic
1199980353 X:152917321-152917343 GCCCCAGCAGCAGTTCCCCAAGG + Exonic