ID: 903012892

View in Genome Browser
Species Human (GRCh38)
Location 1:20343464-20343486
Sequence CACCGGGGGCGGGTGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 0, 3: 52, 4: 489}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903012892_903012903 -3 Left 903012892 1:20343464-20343486 CCCTTCCCCACCCGCCCCCGGTG 0: 1
1: 0
2: 0
3: 52
4: 489
Right 903012903 1:20343484-20343506 GTGATCCTCTCAGCCCCGCGTGG 0: 1
1: 0
2: 1
3: 9
4: 106
903012892_903012909 18 Left 903012892 1:20343464-20343486 CCCTTCCCCACCCGCCCCCGGTG 0: 1
1: 0
2: 0
3: 52
4: 489
Right 903012909 1:20343505-20343527 GGTCCGCCCACCTGCTTCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 198
903012892_903012908 17 Left 903012892 1:20343464-20343486 CCCTTCCCCACCCGCCCCCGGTG 0: 1
1: 0
2: 0
3: 52
4: 489
Right 903012908 1:20343504-20343526 TGGTCCGCCCACCTGCTTCCCGG 0: 1
1: 0
2: 1
3: 9
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903012892 Original CRISPR CACCGGGGGCGGGTGGGGAA GGG (reversed) Intronic
900135578 1:1115737-1115759 CCCCGGGGAGGGGTGGGGAGGGG - Intronic
900164525 1:1239446-1239468 CACCGGGGACGGATGGGCAATGG + Intergenic
900307611 1:2018958-2018980 CGCCGGCGGTGGGTGGGGAGGGG - Intergenic
900416415 1:2537269-2537291 CAGCGGGGCAGGGTGGGGACGGG - Intergenic
900479814 1:2892650-2892672 CTCCAGGAGCGGGTGGGGAGGGG + Intergenic
900522128 1:3110904-3110926 CCCCGGGGTGGGGTGGGGGATGG + Intronic
900698452 1:4027653-4027675 CACCGTGGGAGGGTGGGGGCGGG + Intergenic
901007891 1:6180448-6180470 CGCCGGGTGAGGGTGGGGACCGG + Intergenic
901044204 1:6385815-6385837 TGCCGGGGGCTGGTGGGGGAGGG - Intronic
901086623 1:6614894-6614916 GACCGCGGGCGGGTGGGGGAGGG + Intronic
901758439 1:11455493-11455515 CACCGGGCGGTGGTGGGGCAGGG + Intergenic
902384648 1:16069487-16069509 CACTGGGGGCCGGTGGGGTCGGG - Intronic
902700100 1:18166659-18166681 CACCGAGGGCCTGAGGGGAAGGG + Intronic
902843617 1:19092236-19092258 CACTGGGGGAGAGTGGGGAAAGG + Intronic
902966917 1:20011878-20011900 CTCCAGGGGGTGGTGGGGAATGG + Intergenic
903012892 1:20343464-20343486 CACCGGGGGCGGGTGGGGAAGGG - Intronic
903389520 1:22954057-22954079 CAGCGCGGGCGGGTGAGGAAGGG - Intronic
904733300 1:32611497-32611519 CGACGGGGGCGGTGGGGGAAGGG - Intronic
904816617 1:33207106-33207128 CACCGGGGCCTGTTGGGGAGTGG - Intergenic
905934337 1:41811687-41811709 CACGGGGAGGGGGTGGGGAAAGG + Intronic
907237465 1:53062117-53062139 CTCCCGGGGCGGGTGGGGAGTGG + Intronic
910055563 1:83029521-83029543 CACTGGGGCCTGGTGGGGAGCGG + Intergenic
911220657 1:95241856-95241878 CCCCTGGGGGGGGTGGGGAGGGG - Intronic
912536877 1:110380628-110380650 GGGCGGGGGCGGGGGGGGAAGGG + Intronic
912927980 1:113929932-113929954 CACCGGCGGTGAGTGGGGACGGG + Exonic
913173780 1:116255806-116255828 CACCTGGGGAGGCTGGGGGATGG - Intergenic
913261742 1:117004860-117004882 AAACTGGGGCGGGTGGGGGAGGG + Intronic
913609060 1:120492937-120492959 GACAGGGGGCTGGCGGGGAATGG + Intergenic
914096424 1:144547809-144547831 CACTGGGGGCAGGGGAGGAAAGG + Intergenic
914204767 1:145517512-145517534 GTCAGGGGGCTGGTGGGGAATGG - Intergenic
914302090 1:146386159-146386181 CACTGGGGGCAGGGGAGGAAAGG - Intergenic
914370796 1:147022715-147022737 GCCAGGGGGCTGGTGGGGAATGG + Intergenic
914483890 1:148090699-148090721 GTCAGGGGGCTGGTGGGGAATGG - Intergenic
914582131 1:149028902-149028924 GACAGGGGGCTGGTGGGGAATGG - Intronic
914969521 1:152294782-152294804 CACCGGGGACGGTTGTGGAGTGG - Intergenic
915333791 1:155129176-155129198 CACAGGGAGCGGGTGGCGGAGGG - Intronic
915586360 1:156845904-156845926 GCCGCGGGGCGGGTGGGGAAGGG - Intronic
915633967 1:157173707-157173729 CACCTGGGGCAGGTCGGGGACGG + Intergenic
915719905 1:157977303-157977325 CACTGGGGGCGGGAGGGGGACGG + Intergenic
916371083 1:164094959-164094981 CACCGGGGGCTATTGGGGGATGG + Intergenic
916989267 1:170224857-170224879 TACCGGAGGCTGGTGGGGATGGG + Intergenic
919805291 1:201377765-201377787 GACAGGGGACGGGTGGGGCAGGG + Intronic
919825879 1:201502789-201502811 CACTGGGGGCAAGTGGGGAAAGG - Intronic
920007652 1:202845081-202845103 GACTGGGGAGGGGTGGGGAAAGG + Intergenic
921376862 1:214483471-214483493 AACTGGAGGCGGGTGGGGAAGGG - Intronic
922196179 1:223362942-223362964 AAGCGGGGGCGGGGGGGGGAGGG - Intronic
922315025 1:224434567-224434589 CTCCGGGAGGGGGGGGGGAAAGG - Intronic
922420980 1:225461070-225461092 CAGCGGGGGATGGTGGGGAAGGG + Intergenic
923248402 1:232156403-232156425 CACCGGGGCCTGCTGGGGAATGG + Intergenic
923747012 1:236710886-236710908 CACGGGTGGGGGGTAGGGAAGGG - Intronic
923943542 1:238856415-238856437 CACCAGGGCCTGGTGGGGAGTGG + Intergenic
924457759 1:244231739-244231761 CACTCGGGGCGGGTTGGAAAAGG + Intergenic
1062932546 10:1362786-1362808 CAGCGAGGCCGGGTGGGGAGCGG - Intronic
1067071733 10:43137814-43137836 CACCGCGGGCTGGCGGGGGAGGG - Intergenic
1067697863 10:48548617-48548639 CACAAGGAGCGGGTGGGGAGTGG - Intronic
1067928652 10:50537623-50537645 CACCGGGGCCTGTTGTGGAATGG - Intronic
1068125612 10:52838859-52838881 CACCGGGGCCTGTTGGGGGATGG - Intergenic
1068565912 10:58575188-58575210 CACCGGGGCCTGTTGGGGAGTGG - Intronic
1069641032 10:69955630-69955652 CACCGTGGCAGGCTGGGGAAGGG + Intronic
1069788431 10:71004496-71004518 CATCTGGGGCTGCTGGGGAAGGG - Intergenic
1070554153 10:77515202-77515224 CACCGGGGGATGGGGGGGAAAGG + Intronic
1071747557 10:88438962-88438984 CACCGGGGGCGGGTGGGAGTGGG + Intronic
1072019172 10:91381558-91381580 CACAGGGGGCTGGTGGGGGGTGG - Intergenic
1072782565 10:98260464-98260486 CACCGGGGGCGGGGGGTGGGGGG + Intronic
1073082642 10:100869575-100869597 CACAGGGGTGGGGTGGGGCATGG - Intergenic
1073084957 10:100882412-100882434 CTCGGGGGGCTGGTGGGGAGGGG + Intergenic
1073148917 10:101298519-101298541 CACTGAGGGCTGGCGGGGAATGG + Intergenic
1073273173 10:102284422-102284444 TACCAGGGGCTGGAGGGGAAGGG - Intronic
1073487900 10:103832742-103832764 CACTGGGGCAGGGTGGGGGAGGG + Intronic
1073554826 10:104439155-104439177 CACAGGGGTGGGTTGGGGAAGGG + Intronic
1074702908 10:116108047-116108069 CCCTGGGAGGGGGTGGGGAAAGG + Intronic
1074715622 10:116215882-116215904 CTCCAGGGGCTGGTGGGGAGAGG - Intronic
1074850863 10:117438715-117438737 GGGGGGGGGCGGGTGGGGAAGGG - Intergenic
1076027535 10:127128546-127128568 CACCGGGGCCTGCTGGGGAGTGG - Intronic
1076053341 10:127352218-127352240 CATCGGGGAGGGGTGGGGAGGGG + Intronic
1076053359 10:127352258-127352280 CATCGGGGAGGGGTGGGGAGGGG + Intronic
1076680478 10:132168974-132168996 CACACAGGGCGGGAGGGGAAAGG - Exonic
1076680806 10:132170280-132170302 CCCCGAGGGCGGCTGGGGACAGG + Intronic
1076683530 10:132186903-132186925 CAGCGGGGGCGGGACCGGAACGG + Exonic
1076996224 11:298770-298792 CCCAGGGTGTGGGTGGGGAAGGG - Intronic
1077015950 11:399305-399327 CAGAGGGGGCAGGTGGAGAAGGG - Intronic
1077063313 11:627021-627043 CACTGGGGGCGGGTGGGGCCCGG + Intronic
1077628969 11:3797861-3797883 CACCGGCGGGGTGTCGGGAAGGG + Intronic
1079415276 11:20229160-20229182 CACCGGGGCCTGTTGGGGATTGG - Intergenic
1079630363 11:22666994-22667016 CACCCGGGGCGGCGGGGGAGGGG + Intronic
1080197715 11:29631725-29631747 CACCTGGCTGGGGTGGGGAAAGG - Intergenic
1080246891 11:30189397-30189419 CACTGGGGGAGGGTCAGGAAAGG + Intergenic
1080606548 11:33869310-33869332 CACCGGGGGTGGCAGGGGCAGGG + Intronic
1080639554 11:34150775-34150797 GAGCGTGGGCGGGTGAGGAATGG + Intergenic
1081831873 11:46121426-46121448 GCCCGGGGCCGGGTGGTGAATGG - Intergenic
1081911092 11:46700505-46700527 CCCCGGGTGGGGATGGGGAAAGG - Intronic
1081981432 11:47269619-47269641 CACCGGGCGCGCGCGGGGAGTGG - Intronic
1082005044 11:47414666-47414688 CCCAGGGGAAGGGTGGGGAAGGG + Intronic
1082117245 11:48340938-48340960 CACCGGGGCCTGTTGGGGGATGG + Intergenic
1082616495 11:55367605-55367627 CACCGGGGCCTGTTGGGGAGTGG - Intergenic
1084056755 11:66638909-66638931 CTCAGGGGGCGGTGGGGGAAGGG - Intronic
1084388133 11:68856896-68856918 CACCGGAGGTGGGTGAGGAGGGG + Intergenic
1085561139 11:77473759-77473781 CGACGCGGGCGGGGGGGGAAGGG + Exonic
1085614601 11:77986822-77986844 CACCGGGGCCTGTTGGGGAGTGG + Intronic
1087462603 11:98463761-98463783 CACCGGGGCCTGTTGGGGGATGG + Intergenic
1090817892 11:130314764-130314786 CAGCGGGGCGGGGTGGGGAAGGG + Intergenic
1090996767 11:131873346-131873368 CACCGGGGCCTGTTGGGGGATGG + Intronic
1091304743 11:134530243-134530265 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1091304750 11:134530260-134530282 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1091304757 11:134530277-134530299 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1091304764 11:134530294-134530316 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1091304771 11:134530311-134530333 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1091304778 11:134530328-134530350 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1091304854 11:134530495-134530517 GAACGGAGGAGGGTGGGGAACGG - Intergenic
1092254290 12:6917741-6917763 TCCCAGGGGCGGGTGGGGGAGGG + Intronic
1092271094 12:7023970-7023992 CAAAGAGGGCAGGTGGGGAAGGG - Intronic
1092575863 12:9782068-9782090 CACTGGGGGGGGGTGGGCACTGG + Intergenic
1094533946 12:31304526-31304548 GACCTGGGGGCGGTGGGGAAGGG + Intronic
1095433952 12:42167124-42167146 CACCGGGGCCTGTTGGGGAGTGG + Intronic
1096627636 12:52905101-52905123 CCCCGGGGGATGGGGGGGAAAGG + Intronic
1096668213 12:53180970-53180992 CTCCGGGGGAGGGAGGGGAAAGG + Intronic
1096680377 12:53251994-53252016 CGCCTGGGGTGGGTCGGGAAGGG - Exonic
1096785875 12:54017047-54017069 CAGCTGGGGAGGGTGGGGATGGG + Intronic
1097246898 12:57611820-57611842 CACGGGGGGCGGGGCGGGGACGG - Intronic
1098426112 12:70366680-70366702 CGCCGGGGGCGGGAGGGGGCGGG + Exonic
1098529137 12:71520702-71520724 CACCGGGGCCTGTCGGGGAATGG + Intronic
1099129682 12:78811490-78811512 CATGGGGGGCGGGGGAGGAAGGG + Intergenic
1101790687 12:107924213-107924235 CACCGGGGCCTGTTGGGGCATGG + Intergenic
1104289840 12:127456622-127456644 CACCTGTGTCTGGTGGGGAATGG - Intergenic
1104306147 12:127612415-127612437 AACCTGGGGTGGGTGGGGGAGGG - Intergenic
1104759684 12:131289438-131289460 CAGGGGAGGCGGGTGGGGAAGGG + Intergenic
1104775015 12:131385840-131385862 CAATGGGGGCAGGTGGGGATAGG + Intergenic
1104821029 12:131677775-131677797 CAGGGGAGGCGGGTGGGGAAGGG - Intergenic
1104854063 12:131894190-131894212 CAGTGGGGGCGGGAGGGGAGCGG + Intergenic
1104916635 12:132268915-132268937 CACGTGTGGCGGGTGGGGACGGG + Intronic
1106534955 13:30632121-30632143 CACTGGGGCCTGATGGGGAATGG - Intronic
1107430943 13:40339711-40339733 CACCGGGGACTGTTGGGGGATGG + Intergenic
1107467938 13:40666267-40666289 CACTGGGGGCGGACGGGGAGGGG + Exonic
1107968292 13:45616527-45616549 TATCGGGGGCGGGGGGGCAAGGG - Intergenic
1108533167 13:51346309-51346331 CAGCGGGGCAGGGTGGGGACTGG + Intronic
1109305515 13:60636808-60636830 CAGCAGGAGCGGGTAGGGAAGGG - Intergenic
1109884900 13:68529117-68529139 CACCGGGGCCTGTTGGGGAGTGG + Intergenic
1111867109 13:93782979-93783001 CACTGGGGCCTGTTGGGGAAGGG - Intronic
1111906997 13:94266531-94266553 GACTGAGGGAGGGTGGGGAAGGG - Intronic
1112669570 13:101618966-101618988 CACTGGGGGCAGGTGGGAATTGG + Intronic
1114727168 14:24950896-24950918 CACGGGGGGCCTGTCGGGAAGGG - Intronic
1114756884 14:25269609-25269631 CAGAGTGGGCAGGTGGGGAAGGG - Intergenic
1115102131 14:29714944-29714966 CACCGGGGCCCGTTGGGGGATGG + Intronic
1119436439 14:74600621-74600643 CCCCTGGGGCAGCTGGGGAAAGG + Intronic
1119696953 14:76720672-76720694 CGCAGGAGGCTGGTGGGGAAGGG + Intergenic
1119993019 14:79220909-79220931 CACCGGGGCCTGTTGGGGAATGG - Intronic
1120086742 14:80284200-80284222 CACCGGGGCCTGTTGGGGAGTGG - Intronic
1120578642 14:86217724-86217746 ACCCCGGGGCGAGTGGGGAACGG - Intergenic
1120990181 14:90368597-90368619 CAGCGGGGGCGGGCGGGGTGGGG + Intergenic
1121736129 14:96219405-96219427 CACAGGGGAGGGGTGGGGACCGG + Intronic
1121792650 14:96710708-96710730 CACCTGGGCCAGGTGGGGTATGG - Intergenic
1122395765 14:101428924-101428946 CACCGGGGCCTGTTGGGGGATGG - Intergenic
1122822963 14:104356279-104356301 GCCCAGGGGCGGGTGGGGACAGG - Intergenic
1122977824 14:105178213-105178235 CACCAGGAGTGGATGGGGAAGGG + Intronic
1122982048 14:105196429-105196451 CGCTGGGGGCGGGTGGAGGAAGG - Intergenic
1123025029 14:105420253-105420275 CATCGGGGGCGGGCGGGGCTCGG + Intronic
1123031616 14:105454489-105454511 CACCAGGAGTGGGTGGGGGAAGG - Intronic
1123204028 14:106694767-106694789 CACCGGGGGGGGGGGGGGGGGGG - Intergenic
1202915007 14_GL000194v1_random:161058-161080 TGCCCTGGGCGGGTGGGGAATGG + Intergenic
1124130822 15:26984045-26984067 CACAGTGGGGAGGTGGGGAAGGG - Intronic
1124453615 15:29821781-29821803 CACTGGGGGCGGCCGGGGAGGGG - Intronic
1124590288 15:31047607-31047629 CACTGGGTGGGGTTGGGGAAGGG - Intronic
1125261584 15:37831826-37831848 CACCGAGGCCTGTTGGGGAATGG - Intergenic
1125703974 15:41715063-41715085 CACTGGGGGCGGGTGGGCAGTGG - Intronic
1125743218 15:41981965-41981987 CACGGGGGGCGCCTGGGGATGGG + Exonic
1125784734 15:42305928-42305950 CACCGGGGTCTGTTGGGGGATGG + Intronic
1126349668 15:47731307-47731329 AACCGGGGGCGGGGGGGCAGTGG - Intronic
1126392790 15:48177889-48177911 GGCCTGGGGCGGGCGGGGAAGGG + Intronic
1126680730 15:51199679-51199701 CAGCTGGGGCGGGTGTGGGAGGG - Intergenic
1127606216 15:60591508-60591530 GGCCGGGGGCGGGAGGGGAGGGG - Intronic
1127733552 15:61821212-61821234 CACGGGAAGAGGGTGGGGAAGGG - Intergenic
1127886958 15:63209906-63209928 CACCGGGGCCTGTTGGGGAGTGG - Intronic
1128703538 15:69821743-69821765 CACCTAGGACTGGTGGGGAAGGG + Intergenic
1129058773 15:72843347-72843369 CACCGGGGCCTGTTGGGGAGCGG - Intergenic
1129234918 15:74218265-74218287 CACCGGGCAGGGGTGAGGAAGGG - Intergenic
1129571276 15:76687596-76687618 CACCGGGGCCTGTTGGGGATGGG - Intronic
1130023096 15:80247490-80247512 CTCCTGGGGAGGGTGGGGAGTGG + Intergenic
1132116015 15:99137059-99137081 GACCAGGGGAGGGAGGGGAAGGG + Exonic
1132818325 16:1846785-1846807 CACTGGGGCCTGTTGGGGAATGG + Intronic
1133141998 16:3751958-3751980 AACAGGGGGCAGGTGGGGAAAGG + Intronic
1135357161 16:21778958-21778980 GACTGGGGTGGGGTGGGGAATGG + Intergenic
1135455665 16:22595074-22595096 GACTGGGGTGGGGTGGGGAATGG + Intergenic
1135475172 16:22768158-22768180 CACCGGGGTCTGTTGGGGCATGG + Intergenic
1135712621 16:24730138-24730160 CGCCGGGGCCGGATGGGGGAGGG - Intronic
1136129550 16:28211490-28211512 CCTCGGGGCCCGGTGGGGAAGGG - Exonic
1136403691 16:30031357-30031379 CACAGGGGGCTGCTGGGGACAGG + Intronic
1137547904 16:49416740-49416762 GACCGGTGTCAGGTGGGGAAGGG + Intergenic
1138104725 16:54281960-54281982 CCCCAGGGGCGAGTGGGGAGGGG - Intergenic
1138583970 16:57958643-57958665 CACCGAGGGAGGGTGGAGAGGGG - Intronic
1138917393 16:61483041-61483063 CACCGGGGCCTGTCGGGGAATGG + Intergenic
1139368303 16:66447569-66447591 AACCTGGGGCTGGTAGGGAAGGG - Intronic
1139582479 16:67881570-67881592 CACCCTGGGCGGGTGGAGAAGGG + Intronic
1140136781 16:72213194-72213216 GCCCGGGGGGGGGTGGGGAAAGG + Intergenic
1141821600 16:86449904-86449926 CTCGGAGGGCGGGTGGAGAACGG + Intergenic
1141983153 16:87562251-87562273 CACAGGGGGCGGGGGGGGGGGGG - Intergenic
1141990718 16:87607897-87607919 TTCGGGGGGCGGGTGGTGAAAGG + Intronic
1142186694 16:88698118-88698140 GACCCGCGGCGGGTGGGAAAAGG + Intronic
1142284865 16:89167593-89167615 CAGTGGAGGCGGGTGGGGGAAGG - Intergenic
1142313668 16:89329314-89329336 CACTGGGCGAAGGTGGGGAAGGG + Intronic
1142484691 17:239063-239085 CCCCAGGAGGGGGTGGGGAACGG - Intronic
1143089360 17:4439832-4439854 CACAGAGGGTGGGTGGGGTATGG + Intronic
1143307424 17:5958529-5958551 CACGTGTGGGGGGTGGGGAATGG + Intronic
1143496530 17:7315712-7315734 CACCGGGCGGGAGTGGGGAAGGG - Exonic
1143712731 17:8745246-8745268 CGGTGGGGCCGGGTGGGGAAGGG + Intergenic
1144887879 17:18476419-18476441 CACAGGGTGCTTGTGGGGAAGGG - Intergenic
1145144332 17:20467882-20467904 CACAGGGTGCTTGTGGGGAAGGG + Intergenic
1145175783 17:20699285-20699307 CACAGGGTGCTTGTGGGGAAGGG + Intergenic
1145261068 17:21355175-21355197 CAGCTGGGCCGGCTGGGGAAGGG - Intergenic
1145791534 17:27630830-27630852 CACAGGGTGCTTGTGGGGAAGGG - Exonic
1145991379 17:29081115-29081137 CACAGGGGGAGGGAGGCGAAAGG + Intronic
1146668034 17:34717650-34717672 CCCCTGGGGCGGGAGGGGACAGG - Intergenic
1147466142 17:40612775-40612797 CACTGGAGGCGGGTGCTGAAAGG - Intergenic
1148167307 17:45492230-45492252 CACAGGGGTTGGCTGGGGAACGG + Intergenic
1148457696 17:47819917-47819939 CATGGGGGGCGGGGTGGGAATGG - Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148609999 17:48958714-48958736 GACCTGGGGAGAGTGGGGAAAGG + Exonic
1148974451 17:51514722-51514744 CACCTGGGGTGGGTGGGGCAGGG - Intergenic
1149833556 17:59892650-59892672 CTCCTGGGGCCCGTGGGGAACGG - Intronic
1150398486 17:64838644-64838666 CACAGGGGTTGGCTGGGGAACGG + Intergenic
1150428491 17:65096728-65096750 CACCGGGGCCTGTTGGGGAGTGG + Intergenic
1150532873 17:66003879-66003901 GATAGGGGGTGGGTGGGGAATGG - Intronic
1151495463 17:74455491-74455513 GGCCGGGGGCGTGGGGGGAAAGG + Intergenic
1152034958 17:77866525-77866547 CACCGGGGTTTGGAGGGGAACGG + Intergenic
1152077980 17:78170261-78170283 GACCGGGGAGGGGTGGGGAATGG - Intronic
1152395856 17:80032794-80032816 CACCGGGGGCGGGTGGCTCTGGG - Intronic
1152546628 17:81003624-81003646 CACCAGGGGCTGGTGGGGTTCGG - Intronic
1153908914 18:9689266-9689288 CACCGGGGCCTGTTGGGGGAGGG - Intergenic
1154329492 18:13418106-13418128 CTCAGAGGGCGGGTGGGGAGCGG - Intronic
1155507929 18:26549532-26549554 CGCCCTGGGCGGGTGGGGAAGGG - Intronic
1155954006 18:31942443-31942465 CTCCGGGGGCGGCTGGAGGAGGG - Intronic
1156171845 18:34494371-34494393 CGGCGGGGGCGGGTGGGCACGGG + Intronic
1158645365 18:59241149-59241171 GTCCTGGGGCGTGTGGGGAATGG - Intergenic
1160357191 18:78238677-78238699 CACCGTGGGCGGGAGGCGAGAGG + Intergenic
1160843696 19:1157420-1157442 CACCGGGGCCGCGTGGGGAGAGG - Intronic
1160953442 19:1678802-1678824 CTCCTGAGGCGGGTGGGGAGGGG - Intergenic
1161039140 19:2100748-2100770 CCCCGGGGGCTCCTGGGGAAGGG + Intergenic
1161153034 19:2719579-2719601 CAGCGGTGGGGGGTGGGGGAGGG + Intronic
1161186834 19:2926836-2926858 CCCCGGGGGCTTGTGGGAAACGG + Intergenic
1161194680 19:2979804-2979826 TGCCGGGGGCGGGCGGGGGAGGG + Intronic
1161277788 19:3428578-3428600 CACCGGGGGCCAGTGAGGAGTGG - Intronic
1161345987 19:3768944-3768966 GACCGGGGGCGGGAGGGAGAAGG - Intergenic
1161609215 19:5231632-5231654 GAACGTGGGGGGGTGGGGAAGGG + Intronic
1161659878 19:5539522-5539544 CAGCGGGGAGGGGAGGGGAAGGG + Intergenic
1161925042 19:7293864-7293886 CACCGGGGGCCGGCGGGGGGCGG - Exonic
1162030814 19:7916560-7916582 CACCAGGGGCGGATGGGGGCCGG + Intronic
1162209455 19:9079868-9079890 CACTGAGGTCAGGTGGGGAAAGG + Intergenic
1162312072 19:9913706-9913728 CCCCGGGGGGGCGTGGGGGAGGG + Intronic
1162381314 19:10333469-10333491 CAGCGGGGGCCGGTGAGTAACGG + Exonic
1162533194 19:11247605-11247627 CCCCGGGGGCTGGTGTGGAGGGG + Intronic
1162968120 19:14165343-14165365 CACCTGGTGGGGGTGGGGACCGG - Intronic
1163012087 19:14432990-14433012 CACCGGGGTAGGGTGGGGTGGGG + Intergenic
1163199154 19:15750541-15750563 TGCCGGGGGGTGGTGGGGAAGGG - Intergenic
1165994309 19:39833461-39833483 CACCGGGGGCGGGGAGAGGAGGG + Exonic
1166380507 19:42353015-42353037 GACCCGGGGCGGGTGTGGGAGGG - Exonic
1166425943 19:42677954-42677976 CACCGGGGCCTGTTGGGGGATGG - Intronic
1166670418 19:44706538-44706560 CCCCGGGGGACAGTGGGGAATGG + Intronic
1167074262 19:47239532-47239554 GACCGGGGCCGGGTGGGGGCTGG + Intergenic
1167217157 19:48172120-48172142 CACCGGGGGTGGGTGTGGGTGGG + Intronic
1167243480 19:48359460-48359482 CAGACGGGGTGGGTGGGGAAGGG - Intronic
1167265427 19:48480682-48480704 CCCCGGGGGCTGGTGGGAAATGG + Intronic
1167374304 19:49102972-49102994 CACGGGAGGGGAGTGGGGAAAGG - Intronic
1167459402 19:49616244-49616266 CTGCAGGGGTGGGTGGGGAAGGG + Intronic
1167738617 19:51311519-51311541 CGCCTGGGGCGGGAGGGGTAGGG + Intergenic
1168326102 19:55539221-55539243 CACCAGGGGAGGCTGGGGGAGGG - Intergenic
1168356618 19:55704190-55704212 AACGGGGGGCGGGTGAGCAAGGG - Intronic
1168459073 19:56538832-56538854 CAGCGGGGAGGGGTGGGGAGGGG + Intergenic
925746644 2:7049169-7049191 CAGCGGGGGCTGTTGGGGGATGG + Intronic
925756966 2:7142583-7142605 CACCGGGGCCTGTTGGGGAGTGG + Intergenic
925977820 2:9153284-9153306 CACCGGGGGAGGGTTGGAATTGG - Intergenic
927103721 2:19807127-19807149 CCCGGAGAGCGGGTGGGGAAGGG - Intergenic
927619216 2:24634710-24634732 CTCCGGGGGCGGGGGGGGGGGGG - Intronic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
927858254 2:26540739-26540761 GGGCGGGGGCAGGTGGGGAAGGG + Intronic
928084756 2:28339101-28339123 CACAGGGGGCTGGAGGGGTATGG - Intergenic
928501430 2:31900516-31900538 CACCGGGGCCTGTTGGGGAGTGG + Intronic
929151230 2:38750914-38750936 CGCCGAGGGCGGGGGGGGAGGGG + Intronic
929453861 2:42053186-42053208 CACAGGGTGGGGGTGGGGACAGG - Intronic
931090666 2:58882704-58882726 CACCGGGGCCTGTTGGGGGATGG + Intergenic
932277224 2:70460673-70460695 CTCTGGGGGCTGGTGGGGAGAGG + Intronic
934500621 2:94857797-94857819 CAGTGAGGGCGGGTGGGGGAAGG - Intergenic
934662112 2:96148556-96148578 CACAGGGGGCGGGAGGTGAGTGG + Intergenic
936433194 2:112482025-112482047 CCCCGGGGGAGGGTACGGAAAGG + Intergenic
936600674 2:113890813-113890835 CCCAGGGTGTGGGTGGGGAAAGG + Intronic
937650335 2:124312438-124312460 GCCGGGGGGCGGGTGGGGAGTGG - Intronic
938427385 2:131202917-131202939 CACCGGGGGCAGTGGGGGAGTGG + Intronic
938463321 2:131511644-131511666 CAAGAGGGCCGGGTGGGGAAGGG - Intergenic
938468331 2:131536965-131536987 CACCGGGGGCAGTGGGGGAGTGG + Intergenic
939149986 2:138461480-138461502 CACCGGGGCCTGATGAGGAATGG - Intergenic
939365475 2:141224814-141224836 CATGGGGGTGGGGTGGGGAAGGG + Intronic
939981691 2:148790177-148790199 CACCGGGGCCTGTTGGGGAAGGG - Intergenic
940638826 2:156327923-156327945 CACCGGGGGCGAAGGGGGAGAGG + Exonic
940901454 2:159130036-159130058 TACCGGGGGCGGCGGGGGACTGG + Intronic
942045365 2:172096556-172096578 CACCGGGGTTGGGGGGAGAAGGG + Intergenic
942049293 2:172123857-172123879 CACCGGGGCCTGCTGGGGAGGGG - Intergenic
942068940 2:172297881-172297903 CACCCTGGGCGGGTGGTGTATGG + Intergenic
942241100 2:173964666-173964688 GCCGGGGGGCGGGTGGGGGAGGG - Intronic
943060600 2:183038342-183038364 CGCCGGGGGTGGGGGCGGAAGGG - Exonic
946029937 2:216695678-216695700 CACGGGGTGGGGGTGGGGAGAGG + Intergenic
946155687 2:217805166-217805188 CTGCGGGTGGGGGTGGGGAACGG - Intronic
946164916 2:217858019-217858041 CACAGGAGGCCGGTGGGGAATGG + Intronic
946248094 2:218398567-218398589 CGCGGGGGCCGGGAGGGGAAGGG - Intronic
946320537 2:218951657-218951679 AATTGGGGGCGGGTGGGGGATGG - Intergenic
946396002 2:219444098-219444120 GGCCGGGGCCGGGTGGGAAAGGG - Intronic
946436507 2:219659867-219659889 CAGCGGAGGGGGCTGGGGAATGG - Intergenic
946688512 2:222294300-222294322 CACTGGGGGCGGGAGGAGGAAGG + Exonic
947118852 2:226797364-226797386 CACCGCGGGCTGGTGGGGTGTGG + Exonic
947320152 2:228908278-228908300 CACTGGGGCCTGTTGGGGAATGG + Intronic
947435283 2:230067925-230067947 CACCGAGCGCGGGTGGGGGCGGG - Intronic
947670883 2:231934645-231934667 CACAGGAGGTGGGTGGGGTAGGG + Intergenic
948109817 2:235445465-235445487 AACAGGTGGCGGGTGGGGTAGGG - Intergenic
948142445 2:235683853-235683875 CACTGGGGCCGGGCGGGGGACGG - Intronic
948854753 2:240724925-240724947 CACCGGCGGCGGGGGGGGGGGGG + Intronic
948988726 2:241541286-241541308 CACCAGGGGCGGGGTGAGAAGGG + Intergenic
949017304 2:241720647-241720669 CATCGGGGCCGGGCGCGGAAGGG + Intronic
1169483369 20:6005894-6005916 GCCCGGGGGTGGGCGGGGAAAGG - Intergenic
1171009843 20:21503252-21503274 CACTGGGGGCCTGTGGGAAATGG + Intergenic
1172110889 20:32544296-32544318 GGCAGGGGGCGGGTGGAGAAAGG + Intronic
1172146635 20:32762376-32762398 CAGCGGGAGTGGGTGGGGAGGGG - Exonic
1172330723 20:34074546-34074568 CACAGGGGCGGGGTGGGGATGGG - Intronic
1172621371 20:36320293-36320315 CACGGGGTGGGGCTGGGGAAGGG - Intronic
1172774061 20:37397136-37397158 CGCAGGGAGCAGGTGGGGAAGGG - Intronic
1174168571 20:48602027-48602049 CACCAGGGGAGGGAGGTGAAGGG + Intergenic
1174606839 20:51767740-51767762 CACCCCGGGCGGAGGGGGAAGGG + Intronic
1174656383 20:52175839-52175861 CAGCGGGGGTGCGGGGGGAAGGG - Intronic
1175550988 20:59817532-59817554 CACAGGAGGCGGGTGGGGGATGG + Intronic
1176235951 20:64053610-64053632 CACAGGGGGCTGGTGGGGGTGGG + Intronic
1176418970 21:6499169-6499191 CGGCGGCGGCGGGTGGGAAATGG - Intergenic
1176547026 21:8206540-8206562 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176554931 21:8250749-8250771 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176565977 21:8389587-8389609 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1176573852 21:8433774-8433796 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1177014987 21:15775742-15775764 CAGCGGGGGCGGGGGGGGGGGGG - Intronic
1177966391 21:27732890-27732912 CACCGGGGCCTGTTGGGGGATGG + Intergenic
1178478252 21:32956479-32956501 CACCTGTGGCGGGTGGGCAGGGG + Intergenic
1179058070 21:37954289-37954311 CACAGGCTGCAGGTGGGGAAGGG + Intronic
1179694463 21:43107491-43107513 CGGCGGCGGCGGGTGGGAAATGG - Exonic
1179830752 21:43994529-43994551 CCTCGGGGGCGGGTGTGGACAGG - Intergenic
1180050460 21:45328787-45328809 CACCGCTGGCGGGTGGAAAATGG - Intergenic
1180146039 21:45919596-45919618 CCTCTGGGGCAGGTGGGGAAAGG - Intronic
1180891314 22:19291366-19291388 CGGCGGGGCCGGCTGGGGAATGG - Intronic
1181032949 22:20157055-20157077 GACCAGGGGCAGGTGAGGAAAGG + Intergenic
1181107744 22:20584856-20584878 CACCGGGGGCGGTGGGGGAGTGG - Exonic
1181649487 22:24250952-24250974 ACCCGGGGGCGGGCGGGGAAGGG - Intergenic
1181668743 22:24415785-24415807 CACCTGGGGAGGGTGGGCACAGG - Exonic
1181707884 22:24659794-24659816 ACCCGGGGGCGGGCGGGGAAGGG + Intergenic
1181954626 22:26579415-26579437 CCCTGGGGCCCGGTGGGGAAGGG + Intronic
1182474602 22:30569796-30569818 CACCGTGCCCGGCTGGGGAATGG - Intronic
1182654153 22:31876577-31876599 CACCTGGGCTGGGTGGGCAAGGG - Intronic
1183258073 22:36775902-36775924 CGCTGGGGGCGGGTGGGCAGGGG + Exonic
1183617935 22:38956344-38956366 CACCGGGAAGGGTTGGGGAAGGG + Intronic
1184096160 22:42317639-42317661 CGCTGGGGGCTGGGGGGGAAAGG + Intronic
1184235392 22:43180441-43180463 CAGCAGGGGTGGGTGAGGAATGG + Intronic
1184458748 22:44625584-44625606 CACCGCTGGTGGGTGGGGACTGG + Intergenic
1185039498 22:48497176-48497198 CACCGCAGGCGGGGGCGGAACGG - Intronic
1203251901 22_KI270733v1_random:122825-122847 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203259952 22_KI270733v1_random:167908-167930 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
949189576 3:1235856-1235878 TGCTGGGGGCGGGTGGGGCATGG + Intronic
951080367 3:18444936-18444958 CGGCGGGGGCGGGAGGGGGAAGG + Intronic
951665975 3:25124047-25124069 CACCCGGGGAGGGAGTGGAAAGG + Intergenic
951759984 3:26137243-26137265 CACCAGGGGCAGGGGTGGAAGGG - Intergenic
952208953 3:31209860-31209882 CACTGGGGCCTGTTGGGGAATGG - Intergenic
952844194 3:37673321-37673343 CACAGGGGAAAGGTGGGGAATGG - Intronic
953030628 3:39177698-39177720 TAGCGGGGGCGGGGGGGGGAGGG + Intergenic
953912199 3:46898867-46898889 CACCGGGAGCGGGCGGGCAGAGG - Intronic
954110409 3:48429961-48429983 CACCGGAGCCGGGTAAGGAAGGG - Intronic
954445747 3:50545976-50545998 CACCTGGGTGGGGTGGGGGATGG - Intergenic
955696959 3:61646524-61646546 CATTGGGGGAGGCTGGGGAAAGG - Intronic
958783077 3:98566225-98566247 CACAGGGAGAGGGTGGGGAAGGG + Intronic
958795335 3:98701191-98701213 CACTGGGGGTGGGTGGGAAATGG - Intergenic
959431076 3:106256182-106256204 GCCGGGGGGCGGGTGGGGAAAGG - Intergenic
960373614 3:116871249-116871271 CACCGGGGCCTGTTGGGGTATGG - Intronic
960754689 3:120998538-120998560 CACTGGGGCCTGTTGGGGAATGG - Intronic
961041688 3:123682698-123682720 CAACAGGGGCGGGAGGGGACAGG + Intronic
961674358 3:128555672-128555694 CCCCGGGTGGGGGTGGGGAGTGG + Intergenic
961907390 3:130276843-130276865 CACAGGGGTGGGGTGGGGTAGGG - Intergenic
962750776 3:138433627-138433649 GACCGGGGCGGGGTGGGGAGGGG + Intergenic
963253058 3:143119916-143119938 TACCGGGGGCGGGTTGGGTCGGG + Exonic
964381638 3:156103620-156103642 CACTGGAGGAGGCTGGGGAAGGG - Intronic
964482777 3:157159566-157159588 CGGCGGCGGCGGGAGGGGAAAGG - Intronic
966329317 3:178793509-178793531 CACCCTGGGGGGGTGGGCAATGG + Intronic
966737378 3:183198416-183198438 CACCTGGGGTGGGTGAGGGAGGG + Intronic
967204059 3:187103437-187103459 CTCAGGTGGCGGGTGGGGCACGG - Intergenic
967963295 3:194941974-194941996 GCCCAGGGGCGGGTGGAGAAGGG - Intergenic
968045906 3:195623874-195623896 CCCTGGGGGCGGGTGGGGGTGGG + Intergenic
968915595 4:3495795-3495817 CACCGGGAGCAGCTGGGGAGGGG + Intronic
969061104 4:4435897-4435919 CACCGGGGTAGGGTTGGGAGCGG + Intronic
969641623 4:8402189-8402211 CCCTGGGGCCGGGTGGGGACGGG + Intronic
970132361 4:12885661-12885683 GGCCGGGGGTGGGTGGGGAGGGG - Intergenic
971372377 4:26029168-26029190 CACCAGGGGTGGGTGGGGGCCGG - Intergenic
971889325 4:32497011-32497033 CACCAGGAGAGGGTGGGGTAGGG - Intergenic
973082138 4:46006644-46006666 CACCGGGGCCTGTTGGGGGATGG - Intergenic
974672232 4:65047270-65047292 CACCGAGGAGAGGTGGGGAAGGG - Intergenic
975632867 4:76420242-76420264 TGGCGGGGGCGTGTGGGGAAAGG - Intronic
977040693 4:92013625-92013647 TACTGGGAGCGGGTGGGGATTGG - Intergenic
977445663 4:97128643-97128665 CACCTGGGGCTGTTGGGGAAGGG + Intergenic
978838760 4:113184864-113184886 CACCGGGGCCTGTTGGGGAGTGG - Intronic
980154653 4:129089848-129089870 CACCGGGGCCTGTTGGGGAGTGG + Intronic
980955282 4:139421966-139421988 CACCGGGGCCTGTTGGGGGATGG - Intergenic
982098725 4:151947365-151947387 CAGCTGGGGCGGGGGGGCAAGGG + Intergenic
982746116 4:159104604-159104626 CACGGAGGGCGGCTGGGGAGAGG - Intronic
985645239 5:1081830-1081852 CACTGGTGGCCGGAGGGGAAGGG + Intronic
986626202 5:9725600-9725622 CCACGGGGGCGGATGGGGGAGGG - Intergenic
986878700 5:12143149-12143171 CTCCATGGGTGGGTGGGGAATGG - Intergenic
987132423 5:14871880-14871902 CCCCGGGGGCGGGCTGGGGAGGG + Intergenic
987719647 5:21617300-21617322 CACTGGGGGCTGTTGGGGGATGG + Intergenic
988385492 5:30559219-30559241 CACTGGGGGTGGGTGGGGTGGGG - Intergenic
989314394 5:40060426-40060448 CACCAGGGACGGGTGGGGGGTGG + Intergenic
989379361 5:40798228-40798250 CGCCGGGGGCGGGCGGGGAGGGG + Exonic
991247197 5:64520786-64520808 CAGGGGGTGAGGGTGGGGAATGG + Intronic
994204830 5:97023070-97023092 TACCAGGGGCTGGTGGGGAGAGG - Intronic
995656779 5:114434823-114434845 CTCCGGGGGGAGATGGGGAATGG + Intronic
1000900335 5:166904673-166904695 CACCGGGGAGTGGTGGGGAGAGG + Intergenic
1001372088 5:171215060-171215082 CACCGGGGCCTGTTGGGGGATGG - Intronic
1001628241 5:173154874-173154896 AAGTGGGGGCGAGTGGGGAAGGG + Intronic
1001984290 5:176060908-176060930 CGGTGGGGGCGGGTGGGGGAAGG + Intronic
1002063899 5:176642853-176642875 CACCTGGGGCGGGGGGGGGGGGG - Intronic
1002233186 5:177783157-177783179 CGGTGGGGGCGGGTGGGGGAAGG - Intronic
1002262793 5:178006624-178006646 CGGTGGGGGCGGGTGGGGGAAGG + Intronic
1002638326 5:180618977-180618999 CGCCGCGGGCGGCGGGGGAATGG - Intronic
1002897447 6:1388036-1388058 CAGAGAGGGCGGGTGGGGAGGGG - Intergenic
1003046508 6:2737968-2737990 TGCCGGGGGCGGGTGGGGGGGGG + Intronic
1003129793 6:3386125-3386147 CACCCGGGAGGGGTGTGGAAAGG - Intronic
1003368491 6:5500481-5500503 CACCAGCGGAGGGTGGGGCAAGG + Intronic
1004082423 6:12407709-12407731 CACCGGGAGCTGGGGGCGAAGGG - Intergenic
1004270026 6:14186784-14186806 AACCCGGGGTGGGTGGGGGATGG - Intergenic
1004541020 6:16549996-16550018 CACCGGGGTCTGTTGGGGACTGG + Intronic
1004943857 6:20590513-20590535 CACCGGGGGCTGTTGGGGAGTGG - Intronic
1005251513 6:23951431-23951453 CAGAGGGGTAGGGTGGGGAAGGG - Intergenic
1005944484 6:30585464-30585486 CAACGGGGGCTGGGAGGGAAAGG - Intronic
1006302269 6:33200067-33200089 CCCCGGGGCGGGGCGGGGAAGGG - Intronic
1006375360 6:33668791-33668813 CACTGTGGGGGAGTGGGGAAGGG + Intronic
1007257432 6:40538730-40538752 GACCGGGGGCAGGTGGAGAGGGG - Intronic
1007324953 6:41052917-41052939 CACTGGGGGAGAGTGTGGAAGGG - Intronic
1007623565 6:43229453-43229475 GAGCGCGGGCGGCTGGGGAATGG - Exonic
1008548125 6:52601709-52601731 CACCGGGGTCTGTTGGGGAGCGG + Intergenic
1012590607 6:100975364-100975386 CACCGGGGCTGGCTGGGGGAGGG + Intergenic
1012664418 6:101949514-101949536 CACTGGGGCCGGTTGGGGATGGG - Intronic
1013792621 6:113854809-113854831 CGCTGGGGGAGGTTGGGGAAAGG + Intergenic
1015788954 6:136947153-136947175 CAACGGGGGTGGGGGGGGGACGG - Intergenic
1016395970 6:143624009-143624031 CACTGGGGCAGGGTGGGGAGTGG - Intronic
1016683547 6:146856895-146856917 CACCGGGGCCTGTTGGGGAGTGG + Intergenic
1017151883 6:151288049-151288071 CACCGGGGCCTGTTGGGGAGTGG + Intronic
1017970224 6:159305984-159306006 CACAGGGGGCTGGTGGTGACAGG + Intergenic
1018033729 6:159864718-159864740 CACCGGGGCCTGTTGGGGAATGG + Intergenic
1018836451 6:167487827-167487849 CACCTGCGGCGGGAGGAGAAGGG - Intergenic
1019105472 6:169663955-169663977 CACCTGGTGTGGGTGGGGACGGG - Intronic
1019224596 6:170499900-170499922 CTCCGGGGGAGGGTAGGGGATGG - Intergenic
1019307083 7:340788-340810 CACCGGAGGCGGGAGGGGCCTGG - Intergenic
1019328623 7:452056-452078 GAGTGGGGCCGGGTGGGGAAGGG - Intergenic
1019341356 7:510477-510499 CCCCGGGCTCGGGTGGGGAGGGG + Intronic
1019376361 7:694609-694631 CACTGGAGGTGGGTGGGGGAAGG - Intronic
1019667080 7:2257307-2257329 CACCATGGCCGGGAGGGGAAAGG + Intronic
1022164147 7:27740878-27740900 GAACGGGGCGGGGTGGGGAATGG - Intronic
1022174418 7:27859704-27859726 CACCGGGGCCTGTTGGGGCATGG + Intronic
1023132236 7:37014631-37014653 CACCGGGGCCAGTTGGGGAGTGG - Intronic
1023200470 7:37692152-37692174 CACTGGGGGCTGTTGGGGGATGG - Intronic
1023393618 7:39732948-39732970 TAACGGGGGAGGGTGGGAAAGGG - Intergenic
1023764183 7:43495268-43495290 CACCGGGGCCTGTTGGGGAATGG - Intronic
1025078043 7:55960202-55960224 CACCGGGGCCTGTTGGGGCAAGG + Intronic
1028058704 7:86282238-86282260 CCACAGGGGCGGGTGGGGGAGGG + Intergenic
1029170285 7:98625340-98625362 CACAGGGGCGGGGTGGGGAGGGG + Intronic
1029423379 7:100483312-100483334 CACCTGGGGGCGGTGGGGAAAGG + Intergenic
1029448167 7:100626469-100626491 CAGCGGGGAGGGGTGGGGGAGGG + Intronic
1030033374 7:105388602-105388624 GACGGGGCGGGGGTGGGGAACGG + Intronic
1031152486 7:118070426-118070448 CACCGGGGCCTGTTGGGGGATGG + Intergenic
1032086194 7:128885066-128885088 AGCCTGGGGCGGGAGGGGAAAGG - Intronic
1032913990 7:136466574-136466596 CACCGGGGCCTGATGGGGAGTGG - Intergenic
1034375031 7:150634802-150634824 CACCGGGGCCTGTTGTGGAATGG - Intergenic
1034451867 7:151141508-151141530 CACTGGGAGAGGGTGGGGGAAGG - Intronic
1034730454 7:153382525-153382547 CCAAGGGGTCGGGTGGGGAATGG + Intergenic
1035172314 7:157024154-157024176 CAGGGGGAGCGGGAGGGGAATGG - Intergenic
1035373119 7:158391786-158391808 TACCGGGGGCGGGGGAGGAAAGG + Intronic
1035676946 8:1462681-1462703 CAGCGTGGGTGGCTGGGGAAGGG + Intergenic
1037329303 8:17728130-17728152 TGCCAGGGGCTGGTGGGGAAGGG + Intronic
1037759999 8:21735533-21735555 CACCAGCAGTGGGTGGGGAAGGG - Intronic
1038807991 8:30812474-30812496 GGCCGGGGGCGGGTGGGGAGGGG - Exonic
1039473476 8:37827446-37827468 CCCCAGGGGCAGGTGAGGAAGGG + Intronic
1040456392 8:47602553-47602575 GACCTGGGCTGGGTGGGGAAGGG - Intronic
1041035043 8:53780696-53780718 CACCGGGGGCTGTTGTGGAGTGG - Intronic
1042378255 8:68081134-68081156 CACAGGCGGAGGGTGGGGGATGG + Intronic
1045327536 8:101127764-101127786 CCCCGGGGGCTGGAAGGGAAGGG + Intergenic
1045847814 8:106658141-106658163 CGCCGGGGGCCGGTGGGGCGGGG - Intronic
1047121836 8:121913412-121913434 CACCAGAAGCGGGTGGGTAATGG - Intergenic
1047225176 8:122950408-122950430 CACCGGGGCCTGTTGGGGGATGG + Intronic
1047262383 8:123274426-123274448 GTCCGGGGGCGGAGGGGGAAGGG + Exonic
1048890262 8:138940557-138940579 TGCCGGGGGTGGGTGGGGGAGGG - Intergenic
1049220104 8:141425178-141425200 CACCGGGGGAGGGTGGGGCGGGG + Intronic
1049294840 8:141827008-141827030 GAACGGGAGCAGGTGGGGAAAGG - Intergenic
1049430020 8:142557813-142557835 CCCGGGGGGAGGATGGGGAAAGG - Intergenic
1049628191 8:143636126-143636148 CACCCGGCGCGGGCGGGGAGAGG - Intronic
1049684594 8:143934229-143934251 CGCCGGGGGCGGGGCGGGGAGGG + Intronic
1049798066 8:144505554-144505576 CACCGTGGGCGCGGGGGGAGTGG - Intronic
1049798084 8:144505596-144505618 CACCGTGGGCGCGGGGGGAGTGG - Intronic
1049798102 8:144505638-144505660 CACCGTGGGCGCGGGGGGAGTGG - Intronic
1049837319 8:144745063-144745085 GACGGGGAGCGGGAGGGGAAGGG + Intronic
1051641689 9:19230295-19230317 CACAGGGGTCGGGCGGGGGAGGG + Intergenic
1051641729 9:19230413-19230435 CTGCGGGGGCGGGTGGAAAAGGG - Exonic
1052819203 9:33125595-33125617 CACAGGGAGCAGGTGGGGCATGG - Intronic
1053656553 9:40222751-40222773 CAGTGAGGGCGGGTGGGGGAAGG + Intergenic
1053906904 9:42851969-42851991 CAGTGAGGGCGGGTGGGGGAAGG + Intergenic
1054368656 9:64368973-64368995 CAGTGAGGGCGGGTGGGGGAAGG + Intergenic
1054528063 9:66153534-66153556 CAGTGAGGGCGGGTGGGGGAAGG - Intergenic
1054676284 9:67858725-67858747 CAGTGAGGGCGGGTGGGGGAAGG + Intergenic
1055494773 9:76843309-76843331 CACCGGGGCCTGTTGGGGATGGG + Intronic
1056170575 9:83980697-83980719 CACAGGGAGGGGGCGGGGAAGGG + Intronic
1057158170 9:92863251-92863273 CACTGGGGCCTGTTGGGGAAGGG + Intronic
1057311981 9:93948632-93948654 CGCAGGAGGCGTGTGGGGAACGG - Intergenic
1057801038 9:98191868-98191890 CACCTGGCCCGGGTGGGGAAGGG + Intronic
1058035981 9:100253570-100253592 CACCGGGGGCTGGTGTGGGATGG - Intronic
1058528368 9:105882563-105882585 CACTGGGGCCTGTTGGGGAATGG - Intergenic
1058542022 9:106021365-106021387 CACCAGGGCCTGTTGGGGAAGGG + Intergenic
1058585866 9:106505435-106505457 CACGGGGGGCGGGGGGGTAAAGG + Intergenic
1061329180 9:129881476-129881498 GACGGGGCGTGGGTGGGGAAGGG + Exonic
1061329993 9:129886177-129886199 CGGCAGGGGCGGGTGGGGCATGG + Intergenic
1062424199 9:136498508-136498530 CACCAGGCGGGGGTGGGGATGGG - Intronic
1062519662 9:136952398-136952420 CATCGGGGGCGGGAGTGGCAGGG - Exonic
1062520200 9:136954536-136954558 GACCTGGGGCGGGAGGGGCAGGG - Intronic
1062655938 9:137604804-137604826 GGCAGGGGGCGGGGGGGGAAGGG + Intergenic
1203468303 Un_GL000220v1:105976-105998 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203476124 Un_GL000220v1:149948-149970 CACCGCCGGCGGGCGGGGAGAGG - Intergenic
1203366921 Un_KI270442v1:267106-267128 CACCGGGGACGGTTGTGGAGTGG + Intergenic
1187862387 X:23694769-23694791 AAGCCGGGGCGGGTGGGGATGGG + Intergenic
1188097334 X:26041396-26041418 CTTCTGGGTCGGGTGGGGAATGG + Intergenic
1188556029 X:31412933-31412955 CATCTGGGGAGGGTGGGTAAAGG - Intronic
1192584113 X:72306619-72306641 CCCCGGGGTCGGGTGGCCAACGG - Intronic
1194109248 X:89811757-89811779 CACTGGGGCCTGTTGGGGAATGG + Intergenic
1195351420 X:104000103-104000125 CACCTGGGGGTGATGGGGAAGGG + Intergenic
1195472008 X:105240957-105240979 CACAAGGGGAGGGTGGGGAAAGG + Intronic
1196039291 X:111184556-111184578 CACCGGGGCCTGTTGGGGGATGG - Intronic
1198254676 X:134914787-134914809 CACCGAGGACGGCTGGGGGAGGG - Intronic
1199010286 X:142750183-142750205 CACCGGGGCCGGTTGGGGGGTGG - Intergenic
1199149852 X:144418391-144418413 CACCGGGGCCTGTTGGGGAGTGG + Intergenic
1199409128 X:147499310-147499332 CACCGGGGCCTGTTGGGGTAGGG - Intergenic
1199715158 X:150502825-150502847 CACTGGGGTGGGGTGGGGTAGGG + Intronic
1199771183 X:150976242-150976264 CTCCGGGGTCTGGTGGGGAGGGG + Intergenic
1200068823 X:153517933-153517955 CACAAGGCGCGGGTGGGGATGGG + Intronic
1200461910 Y:3466500-3466522 CACTGGGGCCTGTTGGGGAATGG + Intergenic
1201949287 Y:19546404-19546426 CACTGGGGCCTGTTGGGGAATGG - Intergenic
1202169655 Y:22029193-22029215 AACAGGTGACGGGTGGGGAAAGG - Intergenic
1202221711 Y:22557180-22557202 AACAGGTGACGGGTGGGGAAAGG + Intergenic
1202321407 Y:23638494-23638516 AACAGGTGACGGGTGGGGAAAGG - Intergenic
1202549360 Y:26031562-26031584 AACAGGTGACGGGTGGGGAAAGG + Intergenic