ID: 903014399

View in Genome Browser
Species Human (GRCh38)
Location 1:20352601-20352623
Sequence CACCTCAGCATGCTGTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903014394_903014399 17 Left 903014394 1:20352561-20352583 CCCAGGGACATGGACTGTGTTTA 0: 1
1: 0
2: 1
3: 13
4: 155
Right 903014399 1:20352601-20352623 CACCTCAGCATGCTGTAGCAGGG 0: 1
1: 0
2: 0
3: 30
4: 169
903014395_903014399 16 Left 903014395 1:20352562-20352584 CCAGGGACATGGACTGTGTTTAG 0: 1
1: 0
2: 0
3: 6
4: 165
Right 903014399 1:20352601-20352623 CACCTCAGCATGCTGTAGCAGGG 0: 1
1: 0
2: 0
3: 30
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903014399 Original CRISPR CACCTCAGCATGCTGTAGCA GGG Intronic
900864078 1:5254940-5254962 CTCCTCAGCATCCTTCAGCAAGG - Intergenic
901249060 1:7759033-7759055 CACCTCAGCCTCCAGTAGCTGGG - Intronic
901823982 1:11848515-11848537 CCCCGCAGCATGCTGGAGGAGGG - Intergenic
903014399 1:20352601-20352623 CACCTCAGCATGCTGTAGCAGGG + Intronic
904680236 1:32223942-32223964 ACCCTCAGCAGCCTGTAGCAAGG - Intronic
906382010 1:45338877-45338899 CACCTCAGCCTCCTGTAGCTGGG + Intronic
906428041 1:45730592-45730614 CAGCTAAGCATGCTTGAGCAAGG - Intronic
906988565 1:50713044-50713066 CACCTCAGCCTCCTGTAGCTGGG - Intronic
910607290 1:89100610-89100632 CACCTCAGCTTGTTGGAGCCTGG + Intergenic
910844776 1:91594486-91594508 CACCTCAGGAGGCTGAAGCATGG - Intergenic
911199286 1:95028319-95028341 CACCTCAGCCTCCAGTAGCTGGG + Intronic
912588598 1:110790409-110790431 CACCTCTGCTTGCTGCATCATGG - Intergenic
916882348 1:169032174-169032196 CATCTCAGCACACTGTAGCCTGG + Intergenic
917734886 1:177911274-177911296 TGCCTCAGCATGCTCTTGCAGGG - Intergenic
918190571 1:182170178-182170200 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
920422828 1:205847129-205847151 CACCTCAGCCTCCTGTAACTAGG + Intronic
920423628 1:205854608-205854630 CACCTCAGCCTCCTGTAACTAGG - Intergenic
921809732 1:219498994-219499016 CATCTCGACATGCTGGAGCATGG + Intergenic
924724522 1:246656814-246656836 CACCTTAGCCTCCTGTAGCTGGG - Intronic
1062846244 10:708190-708212 CACCTCCCCATACTGTTGCATGG + Intergenic
1062869308 10:885749-885771 AACCTCAGGATGCTGTAAAATGG + Exonic
1063007385 10:1986429-1986451 CACCACAGCATGGTGAAGCTTGG + Intergenic
1063942619 10:11146016-11146038 CACCTCTCCATGCTGTTGTAAGG - Intronic
1064004766 10:11691042-11691064 CACCTCACCATGCTCTTCCACGG - Intergenic
1064121265 10:12622163-12622185 CACCTCACAAGGCTGTACCAAGG - Intronic
1064325293 10:14345222-14345244 CACCTCAGCTGGGTGTATCAAGG + Intronic
1066986248 10:42469915-42469937 CAACTCAGGAGGCTGTGGCAGGG + Intergenic
1069927526 10:71861207-71861229 CACCTAAGCCTCCTGTAGCTGGG - Intergenic
1070520117 10:77245290-77245312 CATCTCATCATGCTGCAGGATGG + Intronic
1070621638 10:78016759-78016781 CACCTCAGCCTACCGTAGCTAGG - Intronic
1071962571 10:90821500-90821522 CACCTTAGCCTGCAGTGGCAAGG - Intronic
1072138294 10:92567855-92567877 CACCTCAGCCTCCTGTAGCTAGG - Intronic
1073112908 10:101073449-101073471 CACCTCAGATCACTGTAGCAAGG + Intergenic
1073198727 10:101717303-101717325 CACCACAGCCTCCTGTAGCTGGG + Intergenic
1073242402 10:102067010-102067032 CACCCCAGGCTGCTGTAGGAAGG - Exonic
1073385443 10:103123545-103123567 TACCTCAGCAGGCTGTGGTAAGG + Intronic
1073747161 10:106482149-106482171 CTCCCCAGCATTCTGTATCAAGG - Intergenic
1074950694 10:118332056-118332078 TACCTCAGCTTCCTGTAGCTGGG - Intronic
1079067069 11:17304234-17304256 CACCACTGCATGCTCTAGCATGG - Intronic
1081777133 11:45683317-45683339 CACCTCTGCATCCTGTAGGAAGG - Intergenic
1081898445 11:46607147-46607169 TACCTCAGCCTCCTGTAGCTGGG - Intronic
1082277850 11:50240946-50240968 CATCTCATAATGCAGTAGCAAGG - Intergenic
1084639362 11:70415399-70415421 CTCCCCAGCATGCGGCAGCAGGG - Intronic
1087059575 11:93964393-93964415 CACCTCTGCATGGTGTATCTGGG + Intergenic
1087896344 11:103590527-103590549 CACATGAGGATGCTGTAGAAAGG - Intergenic
1089784548 11:120898661-120898683 CACCCCAGGATGCTGCAGCTGGG - Intronic
1091454514 12:596806-596828 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1091735138 12:2914959-2914981 CACCTTAGCAAGCTGCAGAATGG + Intronic
1094035677 12:26067877-26067899 TACCTCAGCCTCCTGTAGCCGGG + Intronic
1098009434 12:66034577-66034599 CACCTCAGCCTCAAGTAGCAGGG + Intergenic
1099205644 12:79723121-79723143 CACCTCAACCTCCTGTAGCTGGG - Intergenic
1101079390 12:101167200-101167222 CACCTCAGAATGTTGAAGCTTGG - Intronic
1103739719 12:123083102-123083124 CACCACAGCCTCCTGTAGCTGGG - Intronic
1107512939 13:41103228-41103250 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1112148621 13:96730845-96730867 CACCTCAGCTTCCTGTAGCTAGG + Intronic
1116840277 14:49813717-49813739 CACCTCAGCTTTCTGTAGCTGGG + Intronic
1118904038 14:70010576-70010598 CCCCTCAGCATGCGCTGGCATGG + Intronic
1120991365 14:90380322-90380344 CACGTGAGGATGCTGCAGCAAGG + Intergenic
1121723916 14:96132154-96132176 CACTTAAGCATGTTGTAGAAGGG + Intergenic
1122496174 14:102157146-102157168 CACCTCAGCCTCTTGTAGCTGGG - Intronic
1122747319 14:103906235-103906257 CTCCTCTGGATGCTGGAGCAAGG + Intergenic
1122975951 14:105170828-105170850 CACCCCAGCAAGGTGCAGCAGGG - Intergenic
1125210088 15:37204367-37204389 CACCTGAGCATGCTGTGGTTGGG + Intergenic
1127282967 15:57507691-57507713 CACCTCTGGATGCTGTGGCAGGG + Intronic
1131384636 15:91993875-91993897 CACCTAAGCAGGCTGTGGAAAGG + Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1134044210 16:11089412-11089434 CCCCTCAGCGTTCTGTAACATGG - Intronic
1134458795 16:14414193-14414215 CACCTCAGCTGGCAGTAGCTGGG + Intergenic
1138947979 16:61875227-61875249 CACCTCAGAAGGTTGTATCATGG + Intronic
1139825374 16:69752971-69752993 CACCTCAGCCTCCTGTAGTGAGG - Intronic
1140132329 16:72174496-72174518 CACCTCGGCATACTCTAGCTAGG - Intronic
1140464337 16:75167711-75167733 CACCTCAGCCTGGAGTAGCTGGG + Intronic
1143601536 17:7949250-7949272 CACCCCTGCATTCTGTAGCATGG + Intronic
1148095070 17:45046848-45046870 CACCTCAGTATGATTTAGCATGG - Intronic
1148164750 17:45475543-45475565 CTCCTCAGCATCCCGGAGCAGGG + Exonic
1150395969 17:64822210-64822232 CTCCTCAGCATCCCGGAGCAGGG + Intergenic
1150679521 17:67273367-67273389 CTACTCAGCAGGCTGTGGCAGGG + Intergenic
1151403494 17:73871667-73871689 CACCTGAGCCTGCAGCAGCAAGG + Intergenic
1151761786 17:76108260-76108282 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1154329672 18:13419443-13419465 CACCCCAGCCTCCTGTAGCCTGG - Intronic
1156205701 18:34883423-34883445 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1160618210 18:80150141-80150163 CACCTCAGGGTGCTGGTGCAGGG - Intronic
1161903811 19:7139933-7139955 CTCCTCGGGATGCTGAAGCAGGG - Intronic
1161915322 19:7224057-7224079 CACCTCAGCCTCCAGTAGCTGGG + Intronic
1166177057 19:41081709-41081731 TCCCACAGCATCCTGTAGCAGGG + Intergenic
1166181307 19:41111132-41111154 CACCTCAGCCTCCTATAGCTAGG + Intergenic
1166779733 19:45335262-45335284 CAACTCAGGAGGCTGAAGCAGGG - Intronic
925269336 2:2591205-2591227 CACTTCAGCCTGCAGTTGCAAGG - Intergenic
926018239 2:9473539-9473561 CACCTTTGCTTGCTCTAGCAGGG + Intergenic
926024046 2:9524374-9524396 CACCTCAGCCTCCTCTAGCTGGG - Intronic
927497885 2:23562963-23562985 GACCTCACCGTGCTGTGGCAAGG - Intronic
927939835 2:27096544-27096566 CACCCCAGCAGACTGTAACAGGG + Intronic
928252264 2:29691637-29691659 CTTCTCAGCATTCTTTAGCATGG - Intronic
928450033 2:31370505-31370527 CAGGTCAGCAAGCTGGAGCAGGG + Intronic
932427952 2:71654975-71654997 CACCTTAGCCTCCTGTAGCTGGG - Intronic
932629539 2:73327441-73327463 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
932799227 2:74724641-74724663 CACCTAATCATCCTATAGCAAGG + Intergenic
934550639 2:95259408-95259430 CATCTCAGCATGCTGCTTCAGGG + Intronic
934601888 2:95664014-95664036 CCCCTCAGCATGCAGTCCCAGGG - Intergenic
936012730 2:108935490-108935512 CACCTCAGCAAGATGTTGCTAGG - Intronic
937453717 2:122023623-122023645 AACCACAGCCTGCTGGAGCAGGG - Intergenic
940214560 2:151290827-151290849 CACCTCAGCCTCCTGTAAAATGG + Intergenic
942825488 2:180170010-180170032 CACCTGACCATGCAGTAGAAAGG - Intergenic
943145879 2:184044277-184044299 CACCTCAGCCTCCTATAGCTGGG + Intergenic
943858195 2:192826551-192826573 AATCTCAGCATGCTGAAGCTAGG - Intergenic
947507059 2:230715814-230715836 CACCTCAGCCTCCTGTAGACGGG + Intronic
947707224 2:232286048-232286070 CACCCCAGCCTGTTGGAGCATGG - Intronic
948601228 2:239108461-239108483 CTCCTCAGCCTGCTGCAGCAGGG - Intronic
1169133697 20:3182685-3182707 CACCTCAGCTTCCTGTAGCTGGG + Intergenic
1172504182 20:35449061-35449083 CACAGCAGCATGCTAGAGCATGG - Intronic
1174501672 20:50989505-50989527 CACATGAGCATGCTGAGGCAGGG - Intergenic
1180744128 22:18075522-18075544 TTGCTCAGCCTGCTGTAGCAGGG - Intergenic
1180833943 22:18920416-18920438 GACTTTAGCATGGTGTAGCAAGG - Intronic
1181065877 22:20305823-20305845 GACTTTAGCATGGTGTAGCAAGG + Intergenic
1182789110 22:32934003-32934025 AACCTCATTATGCTGTGGCAAGG + Intronic
1183807330 22:40222273-40222295 CACCTCAGCATTCTGTAGAGCGG - Intronic
1184118085 22:42433505-42433527 CACCTGAGCAGGCAGTAGCAGGG - Intergenic
1184406933 22:44305674-44305696 AACCACAGCGTGCTGTGGCAGGG - Intronic
1184797228 22:46739235-46739257 CACCTCTGCCTGCAGCAGCAGGG - Intergenic
1203284029 22_KI270734v1_random:145714-145736 GACTTTAGCATGGTGTAGCAAGG - Intergenic
952754314 3:36852726-36852748 CACCTCAGCACACTCCAGCATGG + Intronic
953882784 3:46700317-46700339 GACCACAGCAGGCTGCAGCAGGG - Intergenic
954173984 3:48828604-48828626 CACCTCAGCCTGGAGTAGCTGGG - Intronic
954948522 3:54448125-54448147 CACCTCAGCTTGCTTGAGAATGG - Intronic
955406022 3:58626284-58626306 CACCCCAGGATGCTGACGCAGGG + Intronic
956118450 3:65941903-65941925 CACCTCAGCCTCCTGAAGCTGGG + Intronic
956506940 3:69951209-69951231 CACCTCAGCCTCCCGTAGCTGGG + Intronic
956649095 3:71486897-71486919 CACCAAAGCAAGCTGTACCAGGG - Intronic
961712571 3:128838897-128838919 CTCCTAAGCATGCTGTGGGATGG + Intergenic
963916392 3:150862437-150862459 CACCTCAGCATCCTGGAACTGGG - Intergenic
964634436 3:158844279-158844301 CCCCTCAGCAGGCTGAGGCATGG - Intergenic
967371041 3:188746326-188746348 AACCTCAACATGTTGTAACAGGG + Intronic
970406643 4:15770363-15770385 CACCACAGCAGGCTGTTGAAGGG - Intergenic
970621461 4:17824415-17824437 CAACTAAGCATGTTGTAGAAGGG - Intronic
973278112 4:48331659-48331681 AGCCTCAGCATGCTGTACCATGG + Intergenic
973852685 4:54976935-54976957 CACTTCAGCCTGCAGTAGCGAGG - Intergenic
977087537 4:92621545-92621567 CACCTCAGCTTCCTATAGCTGGG - Intronic
977829327 4:101571664-101571686 GACCTGAGCAAGCTGTAGCCAGG - Intronic
979511833 4:121563122-121563144 CTACTCAGGATGCTGAAGCAGGG - Intergenic
983265375 4:165502291-165502313 CACCTCAGCCTCCTGTAGCTAGG + Intergenic
984528800 4:180890134-180890156 CATCTCAGGCTGCTGTAACAAGG + Intergenic
986835421 5:11631740-11631762 AGTCTCAGCATGCTGCAGCAGGG - Intronic
988578743 5:32450685-32450707 TACCTCAGCCTCCTGTAGCTGGG - Intergenic
989452372 5:41601840-41601862 CACCACAGCATTTTGTAACAGGG - Intergenic
992660163 5:78951650-78951672 CATCTCAGCATGCAGTTTCAGGG + Intronic
992798414 5:80273844-80273866 CACCTCAGTCTCCTGTAGCTGGG + Intergenic
992810972 5:80388191-80388213 CACCTCAGCCTCCTGTAGCTAGG - Intergenic
992940669 5:81758255-81758277 CACATAAGCAGTCTGTAGCATGG - Intergenic
995171890 5:109124111-109124133 CACCTCAGCCTTTTGTAGCTGGG - Intronic
998531620 5:142890400-142890422 CATGTCACCATGCTGGAGCATGG + Intronic
1001287242 5:170432762-170432784 CACCTCAGAAGGTTGTAGCGAGG - Intronic
1001819938 5:174702567-174702589 CACCTCAGCCTCCTGTAGCTGGG + Intergenic
1003400978 6:5790537-5790559 CACCTCTGCCTCCTGGAGCAAGG - Intergenic
1003656172 6:8011152-8011174 CAGCTAAACATACTGTAGCATGG + Intronic
1003957672 6:11179254-11179276 CACCTCCAAATGCTGTTGCAAGG - Intergenic
1004420516 6:15465335-15465357 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1006027206 6:31154751-31154773 CACCTCAGCCTGCTGGCTCAGGG + Exonic
1011012836 6:82721544-82721566 CATCTCAGCATCCCGTAGCTAGG - Intergenic
1012929092 6:105298271-105298293 CACCGCAGCTGGATGTAGCAGGG - Intronic
1015622516 6:135146491-135146513 CATTTCAGCATGCTGAAGAAGGG + Intergenic
1017634435 6:156430304-156430326 CATCTCAGCATGCTAGAGGAAGG + Intergenic
1019207271 6:170372714-170372736 CTCCTCAGCCTCCTTTAGCAGGG - Intronic
1025970029 7:66314397-66314419 CACCTCAGCCTCCTGCAGCTGGG - Intronic
1026150011 7:67779971-67779993 CACCTCAGCCTCCTGTAGCTGGG - Intergenic
1027694601 7:81394184-81394206 AACCTCAGCATAATTTAGCATGG + Intergenic
1028674139 7:93439465-93439487 CACCTCATCATTTTGTAGAAAGG + Intronic
1030304550 7:108004687-108004709 AACCTCCCCAGGCTGTAGCAGGG - Intergenic
1030683042 7:112452274-112452296 CTCCTCAGCCTCCTGTAGCTAGG + Intronic
1033350486 7:140558263-140558285 CACCTCATCACTCTGCAGCAAGG + Intronic
1035107807 7:156456810-156456832 CACCTCAGCAGACTGTACCGAGG + Intergenic
1035190613 7:157164795-157164817 CACCTCAGCATCCTGGTTCACGG - Intronic
1035548622 8:502860-502882 CACCTCAGCATGCACCAACACGG + Intronic
1035548641 8:503019-503041 CACCTCAGCATGCAACAACACGG + Intronic
1038154048 8:24970784-24970806 CACCTTACCATGGTGAAGCAGGG + Intergenic
1040743056 8:50604300-50604322 CACCTCAGCCCCCTGTAGCTGGG - Intronic
1042251906 8:66764582-66764604 CACCTCAGCCTCCTGTAGCTGGG + Intronic
1046263295 8:111799021-111799043 AGCCCCAGCATGCTGTGGCAGGG + Intergenic
1046275904 8:111959315-111959337 CACTTCAGCCTCCTGTAGCTGGG + Intergenic
1048191234 8:132291363-132291385 CACATCAGCAGGCTGTATCTTGG - Intronic
1051250295 9:15152188-15152210 CAACTTGGCATGCTGCAGCAGGG - Intergenic
1052294376 9:26881058-26881080 CACCTCAGCATCCCAAAGCATGG - Intronic
1052456414 9:28705028-28705050 CACCTCAGCCTCCTGTATCTGGG + Intergenic
1056103651 9:83325438-83325460 CACCTCAGCCTCCTATAGCTAGG + Intronic
1057385006 9:94599176-94599198 CATCCCCGCATGCTGTGGCATGG + Intergenic
1057616625 9:96596743-96596765 CACCTCAGCCTCCTGTAGCTGGG - Intronic
1057818605 9:98314363-98314385 AACATCAGAATGCAGTAGCACGG + Intronic
1058789669 9:108430121-108430143 CACCTCAGCCTCCAGTAGCTTGG - Intergenic
1059227259 9:112683356-112683378 CTACTCAGGAGGCTGTAGCATGG + Intergenic
1060059479 9:120446335-120446357 CTCCTCAGTAGGCTGAAGCAGGG - Intronic
1060991957 9:127854484-127854506 CACCCCAGAAGGCTGGAGCAGGG - Exonic
1186099816 X:6144197-6144219 CTCCTTAGCATGCTTGAGCAAGG + Intronic
1186121072 X:6361316-6361338 CACCCCAACATGCGTTAGCATGG - Intergenic
1186622914 X:11260416-11260438 CACCTTAGCATCAGGTAGCAGGG - Intronic
1189533207 X:41908262-41908284 CTACTCAGGATGCTGAAGCAGGG + Intronic
1192154207 X:68731696-68731718 CATCTCAGCCTCCTGTAGCTAGG + Intergenic
1192487461 X:71541584-71541606 GACCTAAGCATTCTGTAGGAAGG + Intronic
1193473768 X:81939262-81939284 CACCTTAGGCTGCTGTAACAAGG - Intergenic
1196032139 X:111102466-111102488 GACCTCAGAATGCTGTTGCCTGG + Intronic
1199867017 X:151860946-151860968 CTCCTTAGCATGCTGATGCAGGG + Intergenic
1201018512 Y:9627654-9627676 CTCCTCAGCAGGCTGAGGCAGGG - Intergenic