ID: 903016684

View in Genome Browser
Species Human (GRCh38)
Location 1:20366321-20366343
Sequence CGGGAGTGGGGACCGACGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903016684_903016693 -4 Left 903016684 1:20366321-20366343 CCGCCCGTCGGTCCCCACTCCCG No data
Right 903016693 1:20366340-20366362 CCCGACGGGCCTCGCATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903016684 Original CRISPR CGGGAGTGGGGACCGACGGG CGG (reversed) Intergenic
No off target data available for this crispr