ID: 903016786

View in Genome Browser
Species Human (GRCh38)
Location 1:20366680-20366702
Sequence GGTCGCGGCGCGGCGTCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903016786_903016795 1 Left 903016786 1:20366680-20366702 CCCGCGGACGCCGCGCCGCGACC No data
Right 903016795 1:20366704-20366726 CGCTGGGTCCCCCGCCCTCCCGG No data
903016786_903016803 19 Left 903016786 1:20366680-20366702 CCCGCGGACGCCGCGCCGCGACC No data
Right 903016803 1:20366722-20366744 CCCGGCAGCCTCCGCGCGCTCGG No data
903016786_903016805 26 Left 903016786 1:20366680-20366702 CCCGCGGACGCCGCGCCGCGACC No data
Right 903016805 1:20366729-20366751 GCCTCCGCGCGCTCGGTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903016786 Original CRISPR GGTCGCGGCGCGGCGTCCGC GGG (reversed) Intergenic
No off target data available for this crispr