ID: 903017521

View in Genome Browser
Species Human (GRCh38)
Location 1:20370811-20370833
Sequence GGCCCCTGGGCTCTAATACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903017521_903017528 4 Left 903017521 1:20370811-20370833 CCCAGTATTAGAGCCCAGGGGCC No data
Right 903017528 1:20370838-20370860 CACGGGCTAATGAAGCTCTCTGG No data
903017521_903017529 18 Left 903017521 1:20370811-20370833 CCCAGTATTAGAGCCCAGGGGCC No data
Right 903017529 1:20370852-20370874 GCTCTCTGGCCCCATCTCGCCGG No data
903017521_903017533 30 Left 903017521 1:20370811-20370833 CCCAGTATTAGAGCCCAGGGGCC No data
Right 903017533 1:20370864-20370886 CATCTCGCCGGCATCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903017521 Original CRISPR GGCCCCTGGGCTCTAATACT GGG (reversed) Intergenic
No off target data available for this crispr