ID: 903018455

View in Genome Browser
Species Human (GRCh38)
Location 1:20377143-20377165
Sequence TACCCTCAGCTCCTCGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903018451_903018455 9 Left 903018451 1:20377111-20377133 CCATCACCTCCTCATCTCTAAAG No data
Right 903018455 1:20377143-20377165 TACCCTCAGCTCCTCGTGGCTGG No data
903018449_903018455 16 Left 903018449 1:20377104-20377126 CCCGCAGCCATCACCTCCTCATC No data
Right 903018455 1:20377143-20377165 TACCCTCAGCTCCTCGTGGCTGG No data
903018452_903018455 3 Left 903018452 1:20377117-20377139 CCTCCTCATCTCTAAAGCACAAA No data
Right 903018455 1:20377143-20377165 TACCCTCAGCTCCTCGTGGCTGG No data
903018450_903018455 15 Left 903018450 1:20377105-20377127 CCGCAGCCATCACCTCCTCATCT No data
Right 903018455 1:20377143-20377165 TACCCTCAGCTCCTCGTGGCTGG No data
903018453_903018455 0 Left 903018453 1:20377120-20377142 CCTCATCTCTAAAGCACAAAGAT No data
Right 903018455 1:20377143-20377165 TACCCTCAGCTCCTCGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903018455 Original CRISPR TACCCTCAGCTCCTCGTGGC TGG Intergenic
No off target data available for this crispr