ID: 903019474

View in Genome Browser
Species Human (GRCh38)
Location 1:20383964-20383986
Sequence TCTGGGGCCCAGGAAGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903019474_903019483 10 Left 903019474 1:20383964-20383986 CCAAATCCTTCCTGGGCCCCAGA No data
Right 903019483 1:20383997-20384019 ACTTTCAGATAGGACTGGTGAGG No data
903019474_903019480 0 Left 903019474 1:20383964-20383986 CCAAATCCTTCCTGGGCCCCAGA No data
Right 903019480 1:20383987-20384009 TTAGCACTCCACTTTCAGATAGG No data
903019474_903019481 5 Left 903019474 1:20383964-20383986 CCAAATCCTTCCTGGGCCCCAGA No data
Right 903019481 1:20383992-20384014 ACTCCACTTTCAGATAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903019474 Original CRISPR TCTGGGGCCCAGGAAGGATT TGG (reversed) Intergenic
No off target data available for this crispr