ID: 903019792

View in Genome Browser
Species Human (GRCh38)
Location 1:20386063-20386085
Sequence CTGTGTTTCTGGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903019792_903019804 16 Left 903019792 1:20386063-20386085 CCTTCTGCCCTCCAGAAACACAG No data
Right 903019804 1:20386102-20386124 GACTTGGCTGCTGTGAACTTTGG No data
903019792_903019798 -6 Left 903019792 1:20386063-20386085 CCTTCTGCCCTCCAGAAACACAG No data
Right 903019798 1:20386080-20386102 ACACAGACCATCAACCCCAGGGG No data
903019792_903019796 -8 Left 903019792 1:20386063-20386085 CCTTCTGCCCTCCAGAAACACAG No data
Right 903019796 1:20386078-20386100 AAACACAGACCATCAACCCCAGG No data
903019792_903019797 -7 Left 903019792 1:20386063-20386085 CCTTCTGCCCTCCAGAAACACAG No data
Right 903019797 1:20386079-20386101 AACACAGACCATCAACCCCAGGG No data
903019792_903019799 0 Left 903019792 1:20386063-20386085 CCTTCTGCCCTCCAGAAACACAG No data
Right 903019799 1:20386086-20386108 ACCATCAACCCCAGGGGACTTGG No data
903019792_903019805 17 Left 903019792 1:20386063-20386085 CCTTCTGCCCTCCAGAAACACAG No data
Right 903019805 1:20386103-20386125 ACTTGGCTGCTGTGAACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903019792 Original CRISPR CTGTGTTTCTGGAGGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr