ID: 903020728

View in Genome Browser
Species Human (GRCh38)
Location 1:20391997-20392019
Sequence TTCTGGATAAGTAACCTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903020728_903020737 16 Left 903020728 1:20391997-20392019 CCCTACAGGTTACTTATCCAGAA No data
Right 903020737 1:20392036-20392058 CTCCAACATTTCCCCATTCTTGG No data
903020728_903020740 18 Left 903020728 1:20391997-20392019 CCCTACAGGTTACTTATCCAGAA No data
Right 903020740 1:20392038-20392060 CCAACATTTCCCCATTCTTGGGG No data
903020728_903020738 17 Left 903020728 1:20391997-20392019 CCCTACAGGTTACTTATCCAGAA No data
Right 903020738 1:20392037-20392059 TCCAACATTTCCCCATTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903020728 Original CRISPR TTCTGGATAAGTAACCTGTA GGG (reversed) Intergenic
No off target data available for this crispr