ID: 903023788

View in Genome Browser
Species Human (GRCh38)
Location 1:20412565-20412587
Sequence TACCTTGATCTGTCTTAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903023781_903023788 28 Left 903023781 1:20412514-20412536 CCAGTCAGCAGGGACACAGCCCT No data
Right 903023788 1:20412565-20412587 TACCTTGATCTGTCTTAGACGGG 0: 1
1: 0
2: 0
3: 5
4: 86
903023782_903023788 9 Left 903023782 1:20412533-20412555 CCCTCTACACCTGCTCCAACTCA No data
Right 903023788 1:20412565-20412587 TACCTTGATCTGTCTTAGACGGG 0: 1
1: 0
2: 0
3: 5
4: 86
903023784_903023788 0 Left 903023784 1:20412542-20412564 CCTGCTCCAACTCAGAGCAGCCT No data
Right 903023788 1:20412565-20412587 TACCTTGATCTGTCTTAGACGGG 0: 1
1: 0
2: 0
3: 5
4: 86
903023783_903023788 8 Left 903023783 1:20412534-20412556 CCTCTACACCTGCTCCAACTCAG No data
Right 903023788 1:20412565-20412587 TACCTTGATCTGTCTTAGACGGG 0: 1
1: 0
2: 0
3: 5
4: 86
903023785_903023788 -6 Left 903023785 1:20412548-20412570 CCAACTCAGAGCAGCCTTACCTT 0: 1
1: 0
2: 2
3: 22
4: 215
Right 903023788 1:20412565-20412587 TACCTTGATCTGTCTTAGACGGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903023788 Original CRISPR TACCTTGATCTGTCTTAGAC GGG Intergenic
903023788 1:20412565-20412587 TACCTTGATCTGTCTTAGACGGG + Intergenic
913382599 1:118227796-118227818 TACCTTGATCTGCTTTAAATCGG - Intergenic
916926811 1:169530232-169530254 TTCCTTGACCTCTCTTAGCCTGG - Intronic
921375882 1:214472801-214472823 GCCCCTGATCTGTCTTATACTGG + Intronic
922976477 1:229788390-229788412 TACCTTTTTCTGTCTTACCCAGG + Intergenic
923460168 1:234202733-234202755 TATTGTTATCTGTCTTAGACAGG - Intronic
1072512824 10:96145697-96145719 AACATTGATCTGTTTTATACTGG + Intronic
1078416318 11:11169063-11169085 TCCCTTGCTCTTTCATAGACAGG + Intergenic
1085685528 11:78618915-78618937 TACCAAAATCTGTCTTAGTCAGG - Intergenic
1094418722 12:30246570-30246592 TTCCTTAATCTGACTAAGACAGG - Intergenic
1097748719 12:63328903-63328925 TGTCTTGATCTATGTTAGACAGG + Intergenic
1106594606 13:31125595-31125617 TACTTTGAGTTGTCCTAGACAGG - Intergenic
1108502833 13:51084117-51084139 TTCCTTGACGTGTCTCAGACTGG - Intergenic
1109746740 13:66633372-66633394 TAGCATGATCTTTCTTAGCCAGG - Intronic
1116248385 14:42449515-42449537 TTTCTTGATTTGTCTTAGAAAGG - Intergenic
1119272575 14:73321901-73321923 TACCTGAATCTGTCATAGAAGGG - Intronic
1119809581 14:77505510-77505532 AACCATGATCTGGTTTAGACAGG - Intergenic
1120015515 14:79468765-79468787 TGCCCTGATCTGGCTTATACTGG - Intronic
1120497177 14:85252114-85252136 TACCTTGATGTGTCTTAGTTTGG + Intergenic
1121919166 14:97864628-97864650 AGCCTTGAGCTGTCTTTGACAGG + Intergenic
1126015939 15:44350650-44350672 TTCCTTGATGTGTCTTTAACTGG - Intronic
1128549388 15:68588463-68588485 AACCTTGATCTGTATTATCCCGG + Intronic
1128910299 15:71507752-71507774 TACTTTGAGTTGTCTTTGACAGG + Intronic
1132461576 16:57881-57903 CACCTTGCTCTTTCTTAGAGTGG - Intergenic
1140827426 16:78719639-78719661 TAGATTGCTCTGTCTTACACTGG + Intronic
1157147467 18:45179017-45179039 TACCTATATCTGTCAGAGACAGG - Intergenic
1157203917 18:45682525-45682547 TACACTGATGTGTTTTAGACAGG - Exonic
1159132990 18:64302271-64302293 TATCTTGCTCTGTCTTACCCAGG + Intergenic
1162832190 19:13292262-13292284 TACCTTCATCTGTCTTTCAGTGG - Intronic
1165639198 19:37370029-37370051 TCCCTTGATCTGTCTTCCAAAGG - Intergenic
927188944 2:20502910-20502932 TTCCTTGATTTGTCTTATAAAGG + Intergenic
932903552 2:75726009-75726031 CACCTGGATCTGTTTTAGAGAGG - Intergenic
933480438 2:82850763-82850785 AACCTTGATTTGTCTGAGGCAGG + Intergenic
936472588 2:112812066-112812088 TACCTTGCTGTTTCTAAGACCGG - Intergenic
937297191 2:120816794-120816816 TCTCTAGATCTGTATTAGACTGG - Intronic
939472040 2:142634926-142634948 TGCTTTGATCTGTCTTACAAAGG + Intergenic
942975381 2:182011083-182011105 TACTTTGATGTGTCTTTGTCTGG + Intronic
1169364514 20:4980923-4980945 TTCCTTAATCTCTCTAAGACAGG + Intronic
1169777344 20:9270120-9270142 TACTTTAAGCTGTCATAGACAGG - Intronic
1176908566 21:14534833-14534855 TACTTTGATCTTTCTTAACCAGG - Intronic
1177369433 21:20182247-20182269 TATCTTGTTCTGTCAGAGACAGG - Intergenic
1184173887 22:42775093-42775115 TGCCTTGCTCTGGCTGAGACTGG - Intergenic
1184377267 22:44122194-44122216 TACCTTGAAAGGTCTTAGCCAGG + Intronic
949993712 3:9600517-9600539 CACCTTGTAATGTCTTAGACTGG + Intergenic
954892307 3:53942151-53942173 CCCTTTGAGCTGTCTTAGACTGG + Intergenic
955469351 3:59270088-59270110 TACCTGGATCTGATTTTGACAGG - Intergenic
958668821 3:97176360-97176382 TTTCTTGATGTGTCTTAGTCTGG + Intronic
970644329 4:18102775-18102797 TACCATGCTCTGTCTTACCCTGG + Intergenic
971203356 4:24534636-24534658 TACCTTGATCTGTCTAGGGAGGG - Intronic
974881258 4:67760047-67760069 GATCTTGCTCTGTCTCAGACTGG - Intergenic
978165409 4:105601365-105601387 CACCTCAATCTATCTTAGACTGG + Intronic
978223933 4:106311255-106311277 TGCCTTGATCTTTCTTGCACAGG - Intronic
980388313 4:132114382-132114404 TACCAAAATCTGTATTAGACAGG + Intergenic
982286996 4:153746242-153746264 TACCTTGTTAAGTTTTAGACTGG - Intronic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
987911406 5:24151268-24151290 TAGCTTAATTTGTGTTAGACTGG - Intronic
988366429 5:30306134-30306156 TACTGTGATGTGTCTTAGTCAGG - Intergenic
992587556 5:78256695-78256717 TTCCTTGATGTGTCTTTGTCTGG - Intronic
996318162 5:122184696-122184718 TACCTTGATGTGTCTCAAGCTGG - Intergenic
996600530 5:125257747-125257769 AACCCTGATCTGTTTCAGACTGG - Intergenic
999558691 5:152774879-152774901 TACATTGATTTGGCTTAGAAAGG + Intergenic
1005527960 6:26670063-26670085 CACCTAGATCTGTATTAGTCAGG - Intergenic
1005542838 6:26831612-26831634 CACCTAGATCTGTATTAGTCAGG + Intergenic
1009013649 6:57873778-57873800 CACCTAGATCTGTATTAGTCAGG + Intergenic
1010436468 6:75837062-75837084 TTCTTTGAGCTGTCTTAAACAGG + Intronic
1010569545 6:77461822-77461844 TATGTAGATCTGTCTCAGACAGG + Intergenic
1013051965 6:106544974-106544996 TACCTTGGTTTGTTTTAAACTGG + Intronic
1015938470 6:138425603-138425625 TTCCTTGATCTCTCCTAGACGGG + Intronic
1018282557 6:162203372-162203394 GACCTTGATCTTCCTTAGACTGG - Intronic
1018387501 6:163318331-163318353 TTCCTTTAGCTGTCTTAGAAAGG - Intergenic
1020522198 7:9205322-9205344 TACTATGATATGTCTTTGACAGG + Intergenic
1020613394 7:10428571-10428593 GTCCTTGGTCTGCCTTAGACAGG + Intergenic
1020709907 7:11594328-11594350 TACCAAAATCTGTCTTAGTCAGG - Intronic
1024350888 7:48362179-48362201 CGTCTTGATCTGTCTTAGACTGG + Intronic
1031085528 7:117298543-117298565 TGCTTTGATCTTTCTTAGACAGG + Intronic
1031101510 7:117486452-117486474 TTCCTTGACCAGCCTTAGACTGG - Intronic
1037495061 8:19431626-19431648 TTCCTTGTTCTGTCTTTGTCTGG + Intronic
1037582926 8:20256374-20256396 CACCTTGATCTGCCTTAGGTTGG + Intronic
1042008374 8:64209209-64209231 TACTTTTATCTGTCTGAGAGTGG - Intergenic
1042717203 8:71787155-71787177 TACCTTGTTTTGTCTTTGTCTGG + Intergenic
1043632205 8:82349809-82349831 TACCTTGACCTGGCCTAGATTGG - Intergenic
1045979013 8:108162133-108162155 TACCTAGATCTGTATCAGCCTGG - Intergenic
1046813606 8:118559231-118559253 TAACTTTATCTGTCTTAATCTGG - Intronic
1049862446 8:144909096-144909118 TACCCTAATCTTTTTTAGACAGG + Intergenic
1052325498 9:27213174-27213196 TACCTTAAGCTCTCTTAGCCTGG + Intronic
1053258393 9:36639103-36639125 TACTGTGATCTGCCTAAGACTGG - Intronic
1058371483 9:104273278-104273300 TACTTTGATCTATTTTAGAGGGG + Intergenic
1188083044 X:25868312-25868334 TACCATGATGTGTCTTGGAGTGG + Intergenic
1193446830 X:81615951-81615973 TACCAAGATCTGTATTAGTCAGG - Intergenic
1197404687 X:126035896-126035918 TACCTAAATCTGTATTAGTCAGG - Intergenic
1197495341 X:127172789-127172811 TACCAAAATCTGTATTAGACAGG - Intergenic
1200313900 X:155110572-155110594 TACCTTGATCAGTCTTGGTGGGG + Intronic