ID: 903024575

View in Genome Browser
Species Human (GRCh38)
Location 1:20418229-20418251
Sequence CTGCTCCTCTAGGGCCTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903024568_903024575 -6 Left 903024568 1:20418212-20418234 CCCCTGGCCTGTAACATCTGCTC No data
Right 903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG No data
903024569_903024575 -7 Left 903024569 1:20418213-20418235 CCCTGGCCTGTAACATCTGCTCC No data
Right 903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG No data
903024561_903024575 22 Left 903024561 1:20418184-20418206 CCCCATTCAAGCCCACACACAAG No data
Right 903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG No data
903024567_903024575 -1 Left 903024567 1:20418207-20418229 CCACTCCCCTGGCCTGTAACATC No data
Right 903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG No data
903024562_903024575 21 Left 903024562 1:20418185-20418207 CCCATTCAAGCCCACACACAAGC No data
Right 903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG No data
903024564_903024575 11 Left 903024564 1:20418195-20418217 CCCACACACAAGCCACTCCCCTG No data
Right 903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG No data
903024565_903024575 10 Left 903024565 1:20418196-20418218 CCACACACAAGCCACTCCCCTGG No data
Right 903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG No data
903024570_903024575 -8 Left 903024570 1:20418214-20418236 CCTGGCCTGTAACATCTGCTCCT No data
Right 903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG No data
903024563_903024575 20 Left 903024563 1:20418186-20418208 CCATTCAAGCCCACACACAAGCC No data
Right 903024575 1:20418229-20418251 CTGCTCCTCTAGGGCCTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903024575 Original CRISPR CTGCTCCTCTAGGGCCTCCC GGG Intergenic
No off target data available for this crispr