ID: 903025812 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:20429324-20429346 |
| Sequence | CTGTGGCACTGCAAAGTGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 903025812_903025819 | 19 | Left | 903025812 | 1:20429324-20429346 | CCTTCCACTTTGCAGTGCCACAG | No data | ||
| Right | 903025819 | 1:20429366-20429388 | CCCATATCCTCCAGGCAGCCTGG | No data | ||||
| 903025812_903025817 | 11 | Left | 903025812 | 1:20429324-20429346 | CCTTCCACTTTGCAGTGCCACAG | No data | ||
| Right | 903025817 | 1:20429358-20429380 | TACACGCTCCCATATCCTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 903025812 | Original CRISPR | CTGTGGCACTGCAAAGTGGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||