ID: 903025812

View in Genome Browser
Species Human (GRCh38)
Location 1:20429324-20429346
Sequence CTGTGGCACTGCAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903025812_903025819 19 Left 903025812 1:20429324-20429346 CCTTCCACTTTGCAGTGCCACAG No data
Right 903025819 1:20429366-20429388 CCCATATCCTCCAGGCAGCCTGG No data
903025812_903025817 11 Left 903025812 1:20429324-20429346 CCTTCCACTTTGCAGTGCCACAG No data
Right 903025817 1:20429358-20429380 TACACGCTCCCATATCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903025812 Original CRISPR CTGTGGCACTGCAAAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr