ID: 903027052

View in Genome Browser
Species Human (GRCh38)
Location 1:20436859-20436881
Sequence CTGTGGGCCTCACACACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903027052_903027057 23 Left 903027052 1:20436859-20436881 CCTACTGTGTGTGAGGCCCACAG No data
Right 903027057 1:20436905-20436927 AAATCAGACACACCCCAGCTTGG No data
903027052_903027058 24 Left 903027052 1:20436859-20436881 CCTACTGTGTGTGAGGCCCACAG No data
Right 903027058 1:20436906-20436928 AATCAGACACACCCCAGCTTGGG No data
903027052_903027059 27 Left 903027052 1:20436859-20436881 CCTACTGTGTGTGAGGCCCACAG No data
Right 903027059 1:20436909-20436931 CAGACACACCCCAGCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903027052 Original CRISPR CTGTGGGCCTCACACACAGT AGG (reversed) Intergenic
No off target data available for this crispr