ID: 903027316

View in Genome Browser
Species Human (GRCh38)
Location 1:20438571-20438593
Sequence AAGGAAATGAAGGCGGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903027305_903027316 15 Left 903027305 1:20438533-20438555 CCGTGGTATGAGCTGCCCTATTT No data
Right 903027316 1:20438571-20438593 AAGGAAATGAAGGCGGCTTTTGG No data
903027309_903027316 0 Left 903027309 1:20438548-20438570 CCCTATTTGGAGGCCCATGTGGC No data
Right 903027316 1:20438571-20438593 AAGGAAATGAAGGCGGCTTTTGG No data
903027310_903027316 -1 Left 903027310 1:20438549-20438571 CCTATTTGGAGGCCCATGTGGCA No data
Right 903027316 1:20438571-20438593 AAGGAAATGAAGGCGGCTTTTGG No data
903027304_903027316 21 Left 903027304 1:20438527-20438549 CCACTGCCGTGGTATGAGCTGCC No data
Right 903027316 1:20438571-20438593 AAGGAAATGAAGGCGGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903027316 Original CRISPR AAGGAAATGAAGGCGGCTTT TGG Intergenic
No off target data available for this crispr