ID: 903029866

View in Genome Browser
Species Human (GRCh38)
Location 1:20456174-20456196
Sequence CTATTTAGAAATGTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903029866_903029870 5 Left 903029866 1:20456174-20456196 CCCAGCTCCACATTTCTAAATAG No data
Right 903029870 1:20456202-20456224 TCCCCAGCCTGTTACCCTCAGGG No data
903029866_903029869 4 Left 903029866 1:20456174-20456196 CCCAGCTCCACATTTCTAAATAG No data
Right 903029869 1:20456201-20456223 CTCCCCAGCCTGTTACCCTCAGG No data
903029866_903029872 6 Left 903029866 1:20456174-20456196 CCCAGCTCCACATTTCTAAATAG No data
Right 903029872 1:20456203-20456225 CCCCAGCCTGTTACCCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903029866 Original CRISPR CTATTTAGAAATGTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr