ID: 903034465

View in Genome Browser
Species Human (GRCh38)
Location 1:20485417-20485439
Sequence TCCGCCGCGGGCGGGGACGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 185}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903034465_903034483 11 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034483 1:20485451-20485473 GCGCTGGGGCCGGGGGCGGCCGG 0: 1
1: 2
2: 24
3: 150
4: 1332
903034465_903034482 7 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034482 1:20485447-20485469 AGCGGCGCTGGGGCCGGGGGCGG 0: 1
1: 1
2: 8
3: 121
4: 1137
903034465_903034486 17 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034486 1:20485457-20485479 GGGCCGGGGGCGGCCGGCCGGGG 0: 1
1: 0
2: 16
3: 168
4: 1281
903034465_903034479 2 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034479 1:20485442-20485464 GGGTCAGCGGCGCTGGGGCCGGG 0: 1
1: 1
2: 9
3: 39
4: 450
903034465_903034475 -5 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034475 1:20485435-20485457 GCGGACAGGGTCAGCGGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 145
903034465_903034484 15 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034484 1:20485455-20485477 TGGGGCCGGGGGCGGCCGGCCGG 0: 1
1: 0
2: 6
3: 110
4: 1058
903034465_903034480 3 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034480 1:20485443-20485465 GGTCAGCGGCGCTGGGGCCGGGG 0: 1
1: 0
2: 4
3: 24
4: 357
903034465_903034485 16 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034485 1:20485456-20485478 GGGGCCGGGGGCGGCCGGCCGGG 0: 1
1: 1
2: 12
3: 205
4: 1383
903034465_903034477 -3 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034477 1:20485437-20485459 GGACAGGGTCAGCGGCGCTGGGG 0: 1
1: 0
2: 0
3: 18
4: 208
903034465_903034489 28 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034489 1:20485468-20485490 GGCCGGCCGGGGACGGCCCGCGG 0: 1
1: 0
2: 3
3: 37
4: 384
903034465_903034476 -4 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034476 1:20485436-20485458 CGGACAGGGTCAGCGGCGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 74
903034465_903034478 1 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034478 1:20485441-20485463 AGGGTCAGCGGCGCTGGGGCCGG 0: 1
1: 0
2: 4
3: 35
4: 390
903034465_903034481 4 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034481 1:20485444-20485466 GTCAGCGGCGCTGGGGCCGGGGG 0: 1
1: 0
2: 4
3: 32
4: 288
903034465_903034488 21 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034488 1:20485461-20485483 CGGGGGCGGCCGGCCGGGGACGG 0: 1
1: 0
2: 8
3: 109
4: 1513
903034465_903034490 29 Left 903034465 1:20485417-20485439 CCCGCGTCCCCGCCCGCGGCGGA 0: 1
1: 0
2: 1
3: 17
4: 185
Right 903034490 1:20485469-20485491 GCCGGCCGGGGACGGCCCGCGGG 0: 1
1: 0
2: 1
3: 15
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903034465 Original CRISPR TCCGCCGCGGGCGGGGACGC GGG (reversed) Exonic