ID: 903043491

View in Genome Browser
Species Human (GRCh38)
Location 1:20549617-20549639
Sequence TCTCAAGTATTGCATGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903043491_903043493 13 Left 903043491 1:20549617-20549639 CCAGATACATGCAATACTTGAGA No data
Right 903043493 1:20549653-20549675 TACAATGCTGTTTCTGACCAGGG No data
903043491_903043494 14 Left 903043491 1:20549617-20549639 CCAGATACATGCAATACTTGAGA No data
Right 903043494 1:20549654-20549676 ACAATGCTGTTTCTGACCAGGGG No data
903043491_903043496 20 Left 903043491 1:20549617-20549639 CCAGATACATGCAATACTTGAGA No data
Right 903043496 1:20549660-20549682 CTGTTTCTGACCAGGGGTGGTGG No data
903043491_903043495 17 Left 903043491 1:20549617-20549639 CCAGATACATGCAATACTTGAGA No data
Right 903043495 1:20549657-20549679 ATGCTGTTTCTGACCAGGGGTGG No data
903043491_903043492 12 Left 903043491 1:20549617-20549639 CCAGATACATGCAATACTTGAGA No data
Right 903043492 1:20549652-20549674 TTACAATGCTGTTTCTGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903043491 Original CRISPR TCTCAAGTATTGCATGTATC TGG (reversed) Intergenic
No off target data available for this crispr