ID: 903048236

View in Genome Browser
Species Human (GRCh38)
Location 1:20580761-20580783
Sequence GATATAAAGCAACAACTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903048235_903048236 -2 Left 903048235 1:20580740-20580762 CCTAACAATATAGCTTCAAAAGA No data
Right 903048236 1:20580761-20580783 GATATAAAGCAACAACTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903048236 Original CRISPR GATATAAAGCAACAACTGAT AGG Intergenic