ID: 903049600

View in Genome Browser
Species Human (GRCh38)
Location 1:20590816-20590838
Sequence TTGGAGAAGCAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1361
Summary {0: 1, 1: 1, 2: 10, 3: 124, 4: 1225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903049600 Original CRISPR TTGGAGAAGCAGAAGGAAGA GGG Intronic
900547125 1:3235434-3235456 TTCCGGAAGCAGAAGGAGGAAGG + Intronic
900762826 1:4484221-4484243 TTAAAGAAGGAGAAGGAAAAGGG - Intergenic
900858261 1:5203706-5203728 TGGCAGGAGCAGGAGGAAGAGGG + Intergenic
900916271 1:5640972-5640994 TGGCTGAAGCAGGAGGAAGACGG + Intergenic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
902194651 1:14789390-14789412 GTGGGGAAGCAGAGGGAAGCAGG - Intronic
902657043 1:17876246-17876268 TGGGTGAAGCACAAGGTAGAAGG + Intergenic
902980251 1:20117615-20117637 TGGGAGAAACAGATGGCAGAAGG + Intronic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903011056 1:20330725-20330747 AGGGAGAGGGAGAAGGAAGAGGG - Intronic
903012601 1:20342318-20342340 GTGGGGGAGCAGAAGGAAGGAGG + Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903253990 1:22079465-22079487 TTGGAATGGTAGAAGGAAGATGG + Intronic
903463553 1:23536067-23536089 TAGGAAAAGCACAAAGAAGATGG - Intergenic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903788183 1:25875197-25875219 TGGGAGGAGCAGAAGGAGCACGG - Intergenic
903882995 1:26524746-26524768 TTTGAGAGGGAGAAGAAAGAGGG + Intergenic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904187099 1:28714087-28714109 TTGGAGGAGCAGAAGAAGCAAGG + Exonic
904203655 1:28838353-28838375 TTGAAGAAGCAGAAGGAACTTGG + Intronic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904824495 1:33265612-33265634 TTGGAGTGGCAGAGGGCAGAGGG + Intronic
905886262 1:41493740-41493762 TGGGAGAGGCAGGTGGAAGAGGG + Intergenic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906504381 1:46367212-46367234 TTGGAGATGAAGAATGCAGATGG - Intergenic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
907137976 1:52157288-52157310 TTGGATAAGCAGGAGGCTGAGGG - Intronic
907942633 1:59104301-59104323 TTGGAGAAAATGAAGGAAAAAGG + Intergenic
907943213 1:59108657-59108679 TTGGGAAAGCAGAAGACAGATGG + Intergenic
908001982 1:59689269-59689291 GCAGAGAAGCAGCAGGAAGAGGG + Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908166411 1:61463472-61463494 TAGGAGGAGGAGGAGGAAGAGGG - Intergenic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908890274 1:68838921-68838943 TTGGAGAAGCACAGAGAAGAGGG + Intergenic
908894219 1:68880765-68880787 TTCGAGGAGCTGAAAGAAGACGG - Intergenic
908909020 1:69050940-69050962 TTGGAGCACCAGAAGCAAAAGGG - Intergenic
909220719 1:72957705-72957727 TTGGAAAAGTAGAAGAAAGTAGG - Intergenic
909572252 1:77128242-77128264 TTAAAGAAGCACAAGAAAGATGG + Intronic
910168312 1:84351570-84351592 TGGATCAAGCAGAAGGAAGATGG + Intronic
910333029 1:86097591-86097613 GAGGAGAAGGAGAAGGACGAGGG - Intronic
910361127 1:86414416-86414438 TTGGAGAAGCAGAAGGCCATTGG - Intergenic
910449807 1:87333748-87333770 TTGGAAAATCAGCAGGAACATGG + Intronic
910774852 1:90864516-90864538 TAGAAGAAGAAGAAGAAAGAAGG - Intergenic
911087006 1:93987508-93987530 TGGGAGAAGGAGAAGGAAAGAGG - Intergenic
911306667 1:96240659-96240681 TTGCAGAAGCATAAGTTAGATGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911780941 1:101877585-101877607 TTGGAATAGGAGAAGAAAGAGGG + Intronic
912178843 1:107193293-107193315 TTGGAGAAACAGCAGCAAGTAGG - Intronic
912498622 1:110107257-110107279 TGGGAGAAGCAGGAGCATGAAGG - Intergenic
912703431 1:111895142-111895164 AGGGAGAAGGAGAAGGAAGGAGG + Intronic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
913235940 1:116783571-116783593 TTGGAGAAATAGAAATAAGACGG - Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913487797 1:119349378-119349400 TTGGAAAATCAGAAAGAAAAAGG + Intergenic
913559627 1:120004606-120004628 ATGAAGAAGCAAAAGGAACAGGG + Intronic
913610215 1:120503506-120503528 CTGGAGAAGCAAACAGAAGAAGG - Intergenic
913638233 1:120785935-120785957 ATGAAGAAGCAAAAGGAACAGGG - Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
913984585 1:143553333-143553355 CTGGAGAAGCAAATAGAAGAAGG + Intergenic
914280215 1:146164027-146164049 ATGAAGAAGCAAAAGGAACAGGG + Intronic
914310542 1:146462120-146462142 TTGGAGGGGCACAAGGAAGTTGG - Intergenic
914320874 1:146558412-146558434 TGGGTGAAGCAGAAGTGAGAAGG - Intergenic
914541260 1:148614966-148614988 ATGAAGAAGCAAAAGGAACAGGG + Intronic
914580975 1:149018733-149018755 CTGGAGAAGCAAACAGAAGAAGG + Intronic
914625380 1:149456279-149456301 ATGAAGAAGCAAAAGGAACAGGG - Intergenic
914992178 1:152508331-152508353 GTGGAGAAGTATAAGCAAGAAGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915145593 1:153794304-153794326 TTGGGGAAGCAGAGGGATGGAGG + Intergenic
915185788 1:154104261-154104283 TAGGAGGAGGAGAAGCAAGATGG + Intronic
915200216 1:154221301-154221323 TTGGAGCAGCCGTAGGAAGGGGG + Intronic
915269983 1:154747038-154747060 TAGGAGGTGCAGGAGGAAGAGGG - Intronic
915311703 1:155008553-155008575 TGGGACCAGGAGAAGGAAGAAGG - Intronic
915646570 1:157276982-157277004 TTGGAGGAGTAGAAGAAAGTTGG + Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915968483 1:160333583-160333605 TTGGTAAAGCAGGAGGCAGAGGG - Exonic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916214361 1:162383098-162383120 TTGGAGTTGGAGAAGCAAGATGG + Intronic
916346546 1:163798050-163798072 TTGAAGAACAGGAAGGAAGAAGG - Intergenic
916616378 1:166445534-166445556 TAGAAGAAGAAGAAGGAAGGAGG + Intergenic
916635425 1:166662749-166662771 ATGGAGTAGAAGATGGAAGAAGG - Intergenic
918181044 1:182086297-182086319 TTGGGGAGGCTGCAGGAAGAAGG - Intergenic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918860984 1:189826064-189826086 TTGGTGAAGCAGCAGCACGATGG - Intergenic
918940752 1:190993352-190993374 TTGGACAAGGAGAAGGCAGGTGG - Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919159329 1:193807898-193807920 TATGTGGAGCAGAAGGAAGATGG + Intergenic
919179065 1:194058444-194058466 TTGGTGAAGCAGGAGAGAGAGGG + Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919354019 1:196498431-196498453 TTGCAGAATTAGAAGAAAGAGGG - Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919811088 1:201409200-201409222 TTGGAGAAGAAGCATGAAGCAGG + Exonic
919842569 1:201619826-201619848 CTGGAGAAGCAGAGGCAAGCTGG + Intergenic
919862451 1:201749519-201749541 TTGGTGGAGCAGAAGGATGCAGG - Intronic
920089686 1:203443413-203443435 TTGCAGAATCAGGAGGAAAAGGG - Intergenic
920160838 1:203996665-203996687 TGGGAGAAGGAGAAGCAGGATGG + Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
921555215 1:216590627-216590649 TTGGAGAAAATGAAGGCAGAAGG + Intronic
921582900 1:216915442-216915464 GTGGAGAGGAAGAAGGGAGAAGG + Intronic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922722751 1:227906882-227906904 AGGGAGAAGCAGAAGGGAAAGGG - Intergenic
922977920 1:229800659-229800681 TTGGAGGGGCAGCAGGAACAGGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923640791 1:235758294-235758316 CTGGGGTAGCAGAAGGAAAATGG + Intronic
923665267 1:235993410-235993432 GTGGGGAAGGAGAAAGAAGAGGG + Intronic
923796981 1:237166238-237166260 TCAGAGAAGCAGATGGAAGTTGG - Intronic
923806028 1:237258956-237258978 CTGGCCAAGCAGAAGGCAGAAGG - Intronic
924131201 1:240910432-240910454 TGGGATAGGCAGGAGGAAGAGGG + Intronic
924135063 1:240957162-240957184 TAGGAAAAGCAGGTGGAAGAAGG + Intronic
924644800 1:245867707-245867729 TGGGAGAAAAACAAGGAAGAGGG + Intronic
1062846029 10:706285-706307 TTGGAGAAGGAGAAGAAGGGAGG - Intergenic
1063057038 10:2517010-2517032 TGGGAGGAGGAGGAGGAAGATGG - Intergenic
1063118791 10:3089864-3089886 TGGGAAAAGTAGAAGGAAGCAGG - Intronic
1063866131 10:10367314-10367336 GTGGGGAAGCGGAGGGAAGAGGG - Intergenic
1064126031 10:12661068-12661090 GTTGAAAAGCAGAAGGAATAGGG - Intronic
1064235569 10:13571079-13571101 TTAGAGATTCAGAAGGAAGGAGG + Intergenic
1064924442 10:20554739-20554761 TCTGAGAAGGAGAAGGATGAAGG - Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065186772 10:23175922-23175944 TTGGCCAAGGATAAGGAAGATGG + Intergenic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065351565 10:24800160-24800182 TTGGAGGACCAGAAATAAGAAGG - Intergenic
1065371515 10:24991631-24991653 TGGGAGAGCCAGAAGGGAGATGG - Intronic
1066024806 10:31345085-31345107 TGGGAGAGGCAGAAGGGAGTTGG + Intronic
1066094877 10:32062597-32062619 TTGGACAAGCACAAAGGAGAGGG - Intergenic
1066209633 10:33224213-33224235 GGGGAGAGGCAGAAGGAATAAGG - Intronic
1067248987 10:44571474-44571496 TTGGGGAAGCAGAAGCAAGGGGG + Intergenic
1067264524 10:44726859-44726881 TTGGAGAAGAACAAAGAAGAAGG - Intergenic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1067690294 10:48497463-48497485 AAGGAGATGCAGAAGGCAGAGGG + Intronic
1068301427 10:55146427-55146449 TGGTAGAGGCAAAAGGAAGATGG + Intronic
1068394226 10:56440836-56440858 TTGGACAAGAAGAAGCAATATGG - Intergenic
1068975298 10:63002544-63002566 TTGGATAAGCTGAAAGAAGAGGG - Intergenic
1069098234 10:64286572-64286594 TTGATGAAGCAGGAGAAAGAGGG - Intergenic
1069851052 10:71405240-71405262 TCGGAGCAGGAGAAGGAACATGG - Intronic
1069893215 10:71664835-71664857 AGGGAGGAGGAGAAGGAAGAGGG - Intronic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1069979562 10:72242800-72242822 TAGGAGGGGCAGCAGGAAGAGGG + Intergenic
1070039112 10:72757407-72757429 TTGGGGAAGTAGGAGGAAGAAGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070605876 10:77898304-77898326 TTGGAGAAGGAGAGAGAAAAAGG + Intronic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1071213333 10:83369750-83369772 TTAGAGAGGGAGAAGGGAGATGG - Intergenic
1071213355 10:83369974-83369996 TTAGAGAGGGAGAAGGGAGATGG - Intergenic
1071390996 10:85175264-85175286 TAGGAGAAGGGGATGGAAGAGGG - Intergenic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1071461204 10:85897912-85897934 TTATAGAAGCAGAGAGAAGAAGG - Intronic
1071577560 10:86740533-86740555 TTAAACAAGCAGAAGGAAAAAGG - Intergenic
1071579521 10:86756675-86756697 TTGGCGAAGGAGAAGGGAGGAGG + Exonic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072022350 10:91414702-91414724 TTGGATAGGCAGAAGAAAGTGGG + Intronic
1072054962 10:91745729-91745751 AAAGAGAAGGAGAAGGAAGAAGG + Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072635717 10:97176572-97176594 TGGGAGAAGCGGAAGGCAGGAGG - Intronic
1072932648 10:99680264-99680286 TTGCAGTAGCAGCAAGAAGAGGG - Intronic
1073067921 10:100774857-100774879 TGAGAGCAGCAAAAGGAAGAAGG - Intronic
1073563860 10:104519085-104519107 TGGAAGGAGCAGAGGGAAGAGGG - Intergenic
1074284615 10:112086397-112086419 CTGGAGAAGCTGAGGCAAGAAGG + Intergenic
1074290899 10:112137410-112137432 TTGGAGCAGCAGAGGGGAGCAGG + Intergenic
1074388556 10:113037130-113037152 TTGTAGAAGATGAAGGAAGCTGG + Intronic
1074537911 10:114341887-114341909 TTTGAGAGGCATAAGGCAGAAGG + Intronic
1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG + Intronic
1074723310 10:116282673-116282695 TTGGAGAGGCAGGAGGGAAAGGG - Intergenic
1074732160 10:116390739-116390761 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1075465393 10:122646980-122647002 ATGCAGAAGCAGCAGGAAGCTGG + Intergenic
1075778517 10:125002871-125002893 TTGGAGAAGCAGCTGGAACTGGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075817712 10:125278393-125278415 TTGGGGAAGCAGAAAGAATGGGG - Intergenic
1076160161 10:128237535-128237557 TTACAGATGCTGAAGGAAGATGG + Intergenic
1076182575 10:128421973-128421995 GTCGAGAAGGAGAAGGGAGATGG + Intergenic
1076685385 10:132196321-132196343 TAGGACGAGCAGAAGGATGAGGG - Intronic
1076732848 10:132446971-132446993 TGGGAGAAGCGGGAGGAGGAGGG + Intronic
1076830100 10:132989841-132989863 TTGGAGAAGCAACGGGAAGTGGG + Intergenic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1076987053 11:245486-245508 TTTAGGAGGCAGAAGGAAGATGG - Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078512903 11:11998702-11998724 TGGGAGACGAAGAAGGCAGAAGG - Exonic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1078898096 11:15615928-15615950 GTGGGGATGCAGAAGGCAGAAGG - Intergenic
1078935075 11:15942654-15942676 AGGAAGAAGCAAAAGGAAGAAGG + Intergenic
1079318142 11:19427338-19427360 AAAGGGAAGCAGAAGGAAGAAGG - Intronic
1079467799 11:20748563-20748585 TTGGAGACTGAGAAGGCAGAAGG - Intronic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1080415388 11:32065432-32065454 TTGGATGAGGAGAATGAAGAAGG - Intronic
1080557365 11:33429900-33429922 TAGGAGAAGAAGCAGGAAGAGGG - Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080806928 11:35662611-35662633 TTGGAGGAGGAGGAGGGAGAAGG - Intergenic
1080886906 11:36376293-36376315 TGGGAGGAGAAGGAGGAAGAGGG + Intronic
1081007151 11:37759094-37759116 GTGGAAGAGCAGAAGGAAAAAGG - Intergenic
1081227911 11:40547626-40547648 TTGGAAAAGCAAAAGCAATAAGG - Intronic
1081348000 11:42014030-42014052 TTGGAGAAGCAGCAGAAATGAGG - Intergenic
1081623176 11:44631064-44631086 TGGGGGAAGGAGAAGAAAGAGGG + Intergenic
1081989397 11:47329652-47329674 TTGGGAATGCAGAAGGAAGCAGG - Exonic
1082182246 11:49133707-49133729 TAGGAAAACAAGAAGGAAGATGG - Intergenic
1082211074 11:49502124-49502146 TTGGAAAACCTGAATGAAGAAGG + Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083201209 11:61122161-61122183 TTGCAAAAGTAGAAGGTAGAAGG - Intronic
1084057235 11:66643426-66643448 TTGAAGAAACAGACGCAAGAAGG - Intronic
1084373959 11:68763646-68763668 TGGGTGAAGCAGAAGAAAGCGGG + Intronic
1084719457 11:70894926-70894948 TTAGGGAGGCAGCAGGAAGACGG + Intronic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1086638570 11:89122916-89122938 TTGGAAAACCTGAATGAAGAAGG - Intergenic
1086683262 11:89701239-89701261 TAGGAAAACAAGAAGGAAGATGG + Intergenic
1086725220 11:90173965-90173987 TTGGAGAAACAAGAGGCAGAGGG - Intronic
1086737115 11:90320442-90320464 TTTGAGGGGCAGAAGGCAGAAGG - Intergenic
1086848929 11:91785457-91785479 TTAGAAAAGCAGAAGGTAGCTGG - Intergenic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1086890025 11:92246554-92246576 GAGGAGGAGAAGAAGGAAGAAGG + Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087614417 11:100471656-100471678 CTAGAGAAGTAGCAGGAAGATGG - Intergenic
1088277358 11:108101884-108101906 TCAGAGAGGAAGAAGGAAGAAGG - Intronic
1088712673 11:112522824-112522846 TTCCAGAAGCAGAATGGAGAAGG + Intergenic
1088753577 11:112866323-112866345 TAGGAGAAGTGGAAGGAAGAGGG - Intergenic
1089028709 11:115299701-115299723 CTTAAGAAGCAGAAGCAAGACGG + Intronic
1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG + Intronic
1089097024 11:115927690-115927712 TTCGAGAAGCTGAAAGAAGATGG + Intergenic
1089118861 11:116117855-116117877 GTGGAGAAGCACAGGGAAGGAGG + Intergenic
1089138697 11:116269737-116269759 TTGGAGAGGCAGAGGGGAGGAGG - Intergenic
1089199685 11:116716552-116716574 TGGGAAAAGCAGAAGTCAGATGG + Intergenic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089384254 11:118057639-118057661 TGGGAGAAGAACAAGGATGAAGG + Intergenic
1089623856 11:119739091-119739113 TTGAAGAAACAGAAGCTAGAGGG + Intergenic
1089868521 11:121652297-121652319 GTGCAGAAGCAGAAGTCAGAAGG + Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090681768 11:129067089-129067111 TTTGACCAGCAGTAGGAAGAGGG - Intronic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091603082 12:1929782-1929804 TAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1091856713 12:3746417-3746439 TGGGAGAGGAAGAAGGGAGAGGG - Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092569987 12:9710847-9710869 TGGGAGAGTCAGAAGGGAGATGG - Intergenic
1093084554 12:14852403-14852425 TGGGAGAAGGAGAAGGAGAAGGG - Intronic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093531957 12:20176079-20176101 TTGGGGAGGAAGAAGGATGAAGG - Intergenic
1093652069 12:21657535-21657557 GCGGAGGAGCAGAAGGCAGAGGG - Exonic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094432211 12:30381759-30381781 TTGAAGAAGAAGAACAAAGATGG + Intergenic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1094769843 12:33642626-33642648 TTGGATAAGCTGAGTGAAGATGG + Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095259893 12:40085854-40085876 TGGGAGTAGCAGAAGGAATGCGG - Intronic
1095566061 12:43624244-43624266 TTGGAGAAGCAGGGAGGAGAAGG + Intergenic
1095662856 12:44757936-44757958 TTGAAAAAGCAGAAGGGATATGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096315053 12:50557226-50557248 TTGAAGAAGCAAATGGGAGAGGG + Intronic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096803870 12:54128406-54128428 TTGGAGAGGCAGGAGCAAAAAGG - Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097249217 12:57623196-57623218 GTGGAGAAACAGGTGGAAGATGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097594436 12:61610866-61610888 TTCGAGGGGCAGCAGGAAGAGGG - Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097907962 12:64939990-64940012 TTGGAGGAGCAAAAGGGAAAGGG + Intergenic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098237898 12:68435622-68435644 TGTGAGAAGAAGAAGTAAGAGGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098572498 12:72004714-72004736 TAGCAAAAGCAGAAAGAAGATGG + Intronic
1098624516 12:72646655-72646677 ATGGAAAAGCAGAAGAAAGCAGG + Intronic
1099054687 12:77824473-77824495 TTGGAGCCCTAGAAGGAAGAGGG + Intergenic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099099982 12:78427137-78427159 ATAGAGAAGCAGAAGCCAGATGG - Intergenic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099231624 12:80032518-80032540 TTGAGGAAGGAGTAGGAAGAGGG + Intergenic
1099557801 12:84131425-84131447 GTGGAGAAGCAGAAGACATATGG + Intergenic
1099767668 12:87009420-87009442 TTGGAGGAGGAGAAAAAAGATGG + Intergenic
1099776062 12:87132792-87132814 TTGGAAAGGCAAACGGAAGATGG + Intergenic
1099908263 12:88797889-88797911 TTGGAGAATCATAAGAAACAAGG - Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100245610 12:92753711-92753733 CTGGAGAGGCAGAAGGGAAAAGG - Intronic
1100286582 12:93172630-93172652 TTGGAGGGACAGAAGGAAGTGGG - Intergenic
1100394441 12:94172212-94172234 TAGGAGGAGGAGAAGAAAGAGGG + Intronic
1100550763 12:95644462-95644484 GAGGAGGAGCAGGAGGAAGAGGG - Intergenic
1100604811 12:96142925-96142947 TTGGGGAAGGAGAAGAGAGAGGG + Intergenic
1100762555 12:97825327-97825349 TTGGAGAATCAGAAGGGAGTGGG - Intergenic
1101273346 12:103171998-103172020 TTGGAGAACCAGAATGAATTAGG + Intergenic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101616480 12:106342895-106342917 TTGCAGTATCAGAAGGAAGAGGG + Intronic
1101709492 12:107251609-107251631 TAGAAAAAGCAGACGGAAGAAGG - Intergenic
1102198083 12:111038537-111038559 TTGGAGAGGCAGAGGGAATGGGG - Intronic
1102408767 12:112698837-112698859 AAGGAGAAGGAGAAGGAAAAGGG - Intronic
1102815354 12:115860827-115860849 TGGGAGAAGAAACAGGAAGATGG - Intergenic
1102937798 12:116911967-116911989 TTGGAGAATCTGGAGGAAGCTGG + Intronic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103340758 12:120220001-120220023 TGGGAGGAGGAGAAGGAGGAAGG + Intronic
1103459082 12:121089589-121089611 TTCCAGAAGCAGGTGGAAGATGG + Intergenic
1103858857 12:123995550-123995572 TTGGAGAAGGAGAATGGAGGTGG + Intronic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1104210756 12:126685977-126685999 TTTGGGATGCAGAAGGGAGAGGG - Intergenic
1104378215 12:128283931-128283953 GTTCAGAAGCAGGAGGAAGAGGG + Intronic
1104402275 12:128485867-128485889 TTAGAGGAGGAGGAGGAAGAAGG - Intronic
1104570055 12:129917369-129917391 TTGGAGGAGGAAAAGGAAGGGGG - Intergenic
1104659244 12:130597927-130597949 TTGGAAAAGAAGGAGGAAAATGG + Intronic
1104738944 12:131158589-131158611 ATAGAGAAGAGGAAGGAAGAAGG - Intergenic
1105607758 13:21941395-21941417 TTGGAGAAGAAAAAAGAAGTAGG - Intergenic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106342332 13:28842229-28842251 TGGAGGAAGCAGAAGGAAAAAGG + Intronic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1106506685 13:30376575-30376597 TTGAGGAAGGAAAAGGAAGAGGG + Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1107098253 13:36559985-36560007 TTGGAGAAGGGGAGGTAAGAGGG + Intergenic
1108006108 13:45948312-45948334 ATGAAGAAGCAGCAGCAAGAGGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108588707 13:51893438-51893460 CTGGTGAAGCTAAAGGAAGAGGG - Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1109065385 13:57682152-57682174 TAGGAGTATAAGAAGGAAGATGG - Intronic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109665140 13:65524796-65524818 TGGAAGAGGGAGAAGGAAGAGGG - Intergenic
1109706746 13:66104065-66104087 TTGGATATGCAGAATGAACAAGG - Intergenic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1109765084 13:66884531-66884553 TTGAAGGAGCAGAAGGTAAAAGG + Intronic
1110560767 13:76908770-76908792 CTGGGGAAGCAGAAAAAAGATGG - Intergenic
1110627412 13:77666873-77666895 GAGGAGGAGCAGAAGGAAGTTGG + Intergenic
1110669039 13:78154619-78154641 TGGCAGAAGCAGGAGCAAGAAGG + Intergenic
1110795929 13:79638335-79638357 TTGGAGATGCACATGGAAGTTGG - Intergenic
1111097640 13:83535587-83535609 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
1112204039 13:97306424-97306446 TTGAAGAAGAGGAAAGAAGATGG - Intronic
1112332094 13:98484576-98484598 TTGGAAGTGCAGAAGGACGAGGG - Intronic
1112352974 13:98651943-98651965 TTGGAGCAGCTGGAAGAAGAAGG - Intergenic
1112560297 13:100506772-100506794 TAGGAGGAGAAAAAGGAAGAGGG + Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112740202 13:102464409-102464431 TTGGTGAGGCTGGAGGAAGAAGG + Intergenic
1112765102 13:102733337-102733359 TTTGATAAGCCAAAGGAAGATGG - Exonic
1113081339 13:106523470-106523492 TTGGACAAGGAGGAGGAAGGAGG + Intronic
1113083251 13:106539178-106539200 TTTCAGAAGCAGATGGGAGAAGG - Intergenic
1113322201 13:109244984-109245006 TTAAAGAAGCAGAAGCATGATGG + Intergenic
1113669453 13:112165765-112165787 GAGGAGGAGGAGAAGGAAGAGGG - Intergenic
1113696720 13:112351714-112351736 GTGGAGGGGCAGAAAGAAGAGGG - Intergenic
1114042384 14:18691141-18691163 TAGGAGAAGCTGTAGGAAGACGG - Intergenic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115196547 14:30806695-30806717 TGGGAAAAGCAGGAGCAAGAGGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115617848 14:35113298-35113320 ATGGAGAGGAAGAAGAAAGAAGG + Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115742146 14:36399630-36399652 TGGTAGAAGGAGAGGGAAGAAGG - Intergenic
1115783153 14:36793499-36793521 TGGGAGGAGCAGAGGGGAGAAGG - Intronic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116027240 14:39530056-39530078 TGGGAAAAGCAGTATGAAGAGGG - Intergenic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1116717941 14:48451333-48451355 GAGGAGAAGAAGAAGAAAGAAGG - Intergenic
1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG + Intronic
1116957409 14:50938821-50938843 TTGGACAAACAGAAGTCAGACGG + Intronic
1117152139 14:52900582-52900604 TTTGGGAAGCAGAAGTCAGATGG + Intronic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117266679 14:54095540-54095562 TTAAAGAAGCTGAAAGAAGATGG - Intergenic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1117640501 14:57793399-57793421 TTGGAGGCTCAGAAGGTAGAAGG - Intronic
1117963814 14:61187589-61187611 TTGGAGCAGCAGCAGGAGGCAGG - Intronic
1118177741 14:63458904-63458926 TTGGAGAAATAGAAGTAAAAGGG - Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118805297 14:69231246-69231268 TCTGAGGAGAAGAAGGAAGAAGG - Intronic
1118896100 14:69946905-69946927 TGGCAAAAGCAGAAGCAAGAGGG - Intronic
1119161345 14:72454966-72454988 TTGCAGAAGCAGAAAACAGAGGG - Intronic
1119217608 14:72881106-72881128 TTGGAGCTGCAGGAGGATGATGG - Intronic
1119485181 14:74982167-74982189 TGGGAGAAGCAGCAGGACGTGGG + Intergenic
1119625935 14:76175387-76175409 TTAGAAAAGCAGAAGAGAGATGG - Intronic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1119909799 14:78339151-78339173 TTGGAGAAGCTGAAGGAAAGAGG + Intronic
1120384415 14:83826218-83826240 TTAGAGAAATATAAGGAAGATGG + Intergenic
1120388519 14:83876299-83876321 TGGCAGAAGCAGAAGCAAGGTGG - Intergenic
1120578650 14:86217756-86217778 ATGGAGGAGGAGGAGGAAGAAGG - Intergenic
1120689605 14:87577874-87577896 TTGCAGAAGCAGAGAGAAAATGG + Intergenic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1121283602 14:92717298-92717320 TTCTAGAAACAGAAGAAAGAGGG + Intronic
1121492840 14:94372246-94372268 GTACAGAAGGAGAAGGAAGAGGG - Intergenic
1121614589 14:95304759-95304781 TCGGAGCTGCAGAAGGAAGTGGG - Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1121905201 14:97734800-97734822 TGGAAGAAGGAGGAGGAAGAAGG - Intergenic
1121961256 14:98262367-98262389 TGGCAAAAGCAGAAGCAAGAGGG + Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122667207 14:103339166-103339188 TTGCAGAAAAAGAAAGAAGAGGG + Exonic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122924010 14:104891571-104891593 TTGGGGGAGCATAGGGAAGAAGG + Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123408457 15:20038932-20038954 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1123504609 15:20928062-20928084 TTGGTGAACAAGAAGGAAAATGG + Intergenic
1123517781 15:21045573-21045595 TTGGAGAACTTGAAAGAAGAGGG + Intergenic
1123561858 15:21501763-21501785 TTGGTGAACAAGAAGGAAAATGG + Intergenic
1123598100 15:21939044-21939066 TTGGTGAACAAGAAGGAAAATGG + Intergenic
1124266412 15:28238685-28238707 TTGGAGAACCATAATAAAGATGG - Exonic
1124637328 15:31373555-31373577 AAGGAGAAGCAGGAGGAAAAGGG - Exonic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1125003891 15:34796813-34796835 GAGGAGAGGGAGAAGGAAGAGGG + Intergenic
1125049738 15:35283085-35283107 AGGGAGAAGAAGAAGAAAGAAGG - Intronic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126265054 15:46744470-46744492 TTTGAGGAGCTGAGGGAAGAAGG - Intergenic
1126405679 15:48320310-48320332 TTGGCGAGGAAGACGGAAGAAGG + Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1127157089 15:56139600-56139622 TTTGAGGAGCAGAGAGAAGAAGG - Intronic
1127341090 15:58044824-58044846 TTGGATGAGCAGAGGGAAAAGGG + Intronic
1127734863 15:61831008-61831030 TTTGAGCAGCACAAGGAAGCAGG + Intergenic
1127864107 15:63017729-63017751 TGGCAGAAGAACAAGGAAGATGG - Intergenic
1128046062 15:64618608-64618630 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1128079969 15:64851129-64851151 TCAGAGAAGCAGTGGGAAGAGGG + Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128149930 15:65356293-65356315 TGGGAAAAGAAGAGGGAAGATGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128748805 15:70133872-70133894 ATGGAGAAGCAAAGGGCAGATGG - Intergenic
1128855212 15:71005167-71005189 TTGGGAAAACAGAATGAAGAAGG - Intronic
1129015563 15:72465074-72465096 TGTGTGGAGCAGAAGGAAGAGGG - Intergenic
1129071682 15:72956700-72956722 TTGGGAAAGGAGAAGGAAGCAGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129990612 15:79959313-79959335 TTGGAGGAAGAGAAGGAAAAAGG + Intergenic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130733740 15:86526839-86526861 TTGGAGAAACAGAAGGGGGTTGG + Intronic
1131150129 15:90042572-90042594 TTGGATGATCAGAAGGAAAAAGG + Intronic
1131476358 15:92743551-92743573 TTGGAGAGTCTGAAGGAAGGAGG + Intronic
1131875145 15:96798019-96798041 ATGGAGGAGGAGAAGGAAAAGGG + Intergenic
1132042745 15:98538652-98538674 TTGGAGAACTAGAAGGAGCAAGG - Intergenic
1202970201 15_KI270727v1_random:228889-228911 TTGGTGAACAAGAAGGAAAATGG + Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133354139 16:5123625-5123647 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
1133392753 16:5422766-5422788 ATGGAGAGGGAGAAGGGAGAGGG + Intergenic
1133508425 16:6434313-6434335 TTGGAGATGTAGGAGGAATAAGG - Intronic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133626563 16:7575443-7575465 TTTAAGAAGAAAAAGGAAGAGGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133911460 16:10070001-10070023 TTAGAGAAACAGAAGTAGGAGGG - Intronic
1133962485 16:10506584-10506606 GTAAACAAGCAGAAGGAAGAAGG - Intergenic
1134474914 16:14564811-14564833 TGAGAGAAGCAGAAAGCAGATGG - Intronic
1135192886 16:20369111-20369133 TTTGAGGAGGAGAAGGGAGATGG - Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135384592 16:22026095-22026117 TTGGTGAAGCAGGAGGAATTAGG - Intronic
1135620318 16:23950082-23950104 TGGCAGAAGCAGGAGGAAGTGGG - Intronic
1135727858 16:24870838-24870860 CTAGAGATGCAGAAGAAAGATGG + Intronic
1135759440 16:25125499-25125521 TTGGAGAGGGATAGGGAAGAGGG - Intronic
1135822467 16:25696222-25696244 TTGGAAAGGGAGAGGGAAGAGGG - Intronic
1136065227 16:27754139-27754161 TTGGAGAAGCAGAGGAAAAGGGG - Intronic
1136118618 16:28113045-28113067 TTGGACCTGCAGAGGGAAGAGGG + Exonic
1136294240 16:29292540-29292562 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1136704607 16:32176098-32176120 TTGGAGAACCATAATAAAGATGG - Intergenic
1136763306 16:32753308-32753330 TTGGAGAACCATAATAAAGATGG + Intergenic
1136774258 16:32863210-32863232 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1136804794 16:33117078-33117100 TTGGAGAACCATAATAAAGATGG - Intergenic
1136896353 16:33998304-33998326 ATCGGGGAGCAGAAGGAAGAGGG - Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1138527564 16:57617884-57617906 TTGGGGTACCAGAAGGGAGAAGG - Intronic
1138583600 16:57956965-57956987 TTGGCCAAGCTGAAGGGAGAGGG - Intronic
1138677368 16:58661443-58661465 TTGCAGAACTAGAAGGAACAGGG - Intergenic
1138680767 16:58682242-58682264 TGGGAGAAAGAGCAGGAAGAAGG + Intronic
1138773026 16:59687513-59687535 ATGGTGGAGCAGGAGGAAGAGGG + Intergenic
1138785891 16:59845968-59845990 TGAGAGAAGCAGAATGAAAAAGG - Intergenic
1139221685 16:65188914-65188936 TTGGAAAAGGAGGAGGAAAATGG - Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1140012660 16:71151695-71151717 TGGGTGAAGCAGAAGTGAGAAGG + Intronic
1140820709 16:78660362-78660384 TTGGGGAAACAGAAGGAAATTGG + Intronic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141514560 16:84535092-84535114 TTGGGGGAGAAGGAGGAAGAAGG - Intronic
1142100144 16:88266586-88266608 TTGGAGAAGCAGTAGAAGGTTGG + Intergenic
1142103412 16:88288077-88288099 TTGGAGCAGCAGGAGGAAAAAGG - Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142343465 16:89538733-89538755 TTGGAGACGCATGTGGAAGACGG - Intronic
1203065456 16_KI270728v1_random:1013629-1013651 TTGGAGAACCATAATAAAGATGG + Intergenic
1203076682 16_KI270728v1_random:1125329-1125351 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1142943199 17:3400684-3400706 TGGGACAAACAGAAAGAAGAAGG + Intergenic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143262937 17:5613865-5613887 AAGGAAAAGCAGGAGGAAGAGGG + Intronic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1143975132 17:10823925-10823947 TTGGGGAAGGAGAAGCATGATGG - Exonic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144766625 17:17736491-17736513 TAGGAGATGTAGAAGGAAGTGGG + Intronic
1145123105 17:20278302-20278324 TTGGAGAATTAGAAGCAAGAGGG + Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146430034 17:32784342-32784364 TTGGAGAAGGAGAGGGAATCTGG - Intronic
1146510289 17:33441603-33441625 TGGGAGAAGGAGAAGGAAGGAGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146682795 17:34820668-34820690 TTTCAGGAGCAGGAGGAAGATGG - Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147302794 17:39543247-39543269 TTGATGAGGCAGAAGGAAGGTGG + Intronic
1147439838 17:40441286-40441308 TGGGGGAAGAAGCAGGAAGAGGG + Intergenic
1147490297 17:40859769-40859791 TCAAAGAAGCAGAAGGGAGAGGG - Intergenic
1148020186 17:44548216-44548238 TGGGAGAAGCAAGAGGGAGAAGG + Intergenic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148530463 17:48385429-48385451 TTGGAGAGACATAATGAAGAAGG + Intronic
1148558349 17:48591952-48591974 TGGGACAAGCAGAAGGGAGTTGG + Exonic
1149020235 17:51955195-51955217 TTCGAGATGCAGAAAGATGAAGG - Intronic
1149125836 17:53230924-53230946 TTGGAGAAACAAAAGTGAGATGG + Intergenic
1149174606 17:53854293-53854315 TTGGAGTAACAGAAGGAGAAGGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149333107 17:55606805-55606827 TTTAAGAAGCAGGAGGAAGGAGG - Intergenic
1149662094 17:58339354-58339376 CTTGAGTAGCAGAAGGCAGAGGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150150901 17:62808235-62808257 TCGGGGAAGGAGGAGGAAGAGGG - Exonic
1150222325 17:63503188-63503210 TTTGCGTAGGAGAAGGAAGAGGG - Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151057918 17:71055435-71055457 TTAGAGAAGAGAAAGGAAGAAGG - Intergenic
1151076246 17:71276337-71276359 TTTTAGTAGCAGTAGGAAGAAGG - Intergenic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1152799746 17:82325323-82325345 TTGGAGAAACAGGAGGGAGCTGG - Intronic
1153148677 18:2063845-2063867 TTGAAAAAGGAGAAGGAAAAAGG + Intergenic
1153167028 18:2273816-2273838 TGGCAGAAGCAGGAGCAAGAGGG + Intergenic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1154962507 18:21324008-21324030 TTGGAGATTCTGAAGGGAGAAGG + Intronic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155416117 18:25601559-25601581 TTGGAGGTGCTGAAGGAAGCAGG - Intergenic
1155778133 18:29794218-29794240 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156236912 18:35214496-35214518 TTTGAGAAACAGAAAGAAAAAGG - Intergenic
1156269391 18:35517085-35517107 CTGGAGTTGCAGGAGGAAGATGG - Intergenic
1156361420 18:36387726-36387748 GTGGAGGAGCAGCAGGGAGATGG - Intronic
1156525287 18:37761585-37761607 GTTGAGAAGCAGCAGGAAGTGGG + Intergenic
1156846482 18:41671541-41671563 GTGGAGAAGGAGGAAGAAGAGGG + Intergenic
1157201659 18:45664676-45664698 TTGGGGGAGCTGGAGGAAGAAGG - Intronic
1157313805 18:46572136-46572158 TTGGACAAGGATAAGGATGATGG - Intronic
1157678619 18:49586496-49586518 TTGGATAGACAGAAGGAAGCAGG + Intronic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1158187861 18:54791942-54791964 ATGGAGAGCCAGAAGGGAGATGG - Intronic
1158294312 18:55977936-55977958 TTGGAGATTCAGAAGGGAGGAGG + Intergenic
1158500124 18:57993507-57993529 TTGGAGCAGCTGAGGGAAGCAGG + Intergenic
1158508299 18:58066789-58066811 TGGAAGAATCAGGAGGAAGAGGG + Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158682905 18:59584671-59584693 ATGGTGAAGCACAAGCAAGAGGG - Intronic
1158731068 18:60022962-60022984 TTTAAGAAGAAGAAGCAAGAAGG + Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158985126 18:62807423-62807445 GGGGAGAAGCATAAAGAAGAAGG + Intronic
1159097465 18:63920552-63920574 TTGTAGTAGCAGCAGGAAGTGGG + Intronic
1159482073 18:69002297-69002319 TTGTAGAGGCAGAAAAAAGAGGG + Intronic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1159880986 18:73858336-73858358 TTGGAGAAGGAGGCAGAAGATGG - Intergenic
1160359643 18:78262459-78262481 TTAGAGATCCAGAAGGAAAAGGG + Intergenic
1160429719 18:78803208-78803230 TTGGAGGAGAAGAAGCCAGATGG - Intergenic
1160487895 18:79310090-79310112 GTGGAGAAGAGGCAGGAAGAAGG + Intronic
1161166289 19:2789574-2789596 TGGAAGAAGCAGACAGAAGAAGG + Intronic
1161287995 19:3478690-3478712 TTGGAGGAGCAGCAGGGAAATGG + Intronic
1161348867 19:3781567-3781589 TTGGGGGTGCTGAAGGAAGATGG - Intronic
1161384917 19:3985845-3985867 TGGGAGAAGCCGAGGGAAAAAGG + Intergenic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161842767 19:6692967-6692989 CTGGAGAAGCAGAAGCCCGACGG - Exonic
1161931740 19:7345192-7345214 TTTGAGGAACAGAAGGAAGCAGG - Intergenic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1162843534 19:13373600-13373622 TTGGAGAAGGAGAGGGGAGGTGG - Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163105766 19:15122369-15122391 GAGGAGAAGAGGAAGGAAGAGGG + Intronic
1163283938 19:16334455-16334477 TTGTAGAGACAGAAGGAAGAAGG - Intergenic
1163620896 19:18359397-18359419 TTTGAGGAGCAGGAGGAAGCTGG - Intronic
1163779448 19:19238935-19238957 ATGGATGAGCAGAAGGCAGAGGG - Intronic
1163850223 19:19658678-19658700 TTGGTGAAGATGAAGGGAGAGGG + Intronic
1164292696 19:23881842-23881864 GAGGAGAAGGAGGAGGAAGAGGG + Intergenic
1164441199 19:28282077-28282099 TCGGGGAAGAAGAAGAAAGAAGG - Intergenic
1164567686 19:29339566-29339588 TAGGAGGAGGAGTAGGAAGAAGG + Intergenic
1164592134 19:29512906-29512928 TTGGAGAAGGAGGAAGGAGAGGG + Intergenic
1164917171 19:32061111-32061133 TTGGAGAAGCAGAAACTAGGAGG - Intergenic
1164945295 19:32288254-32288276 GTGGATCAGGAGAAGGAAGAAGG - Intergenic
1165106007 19:33470034-33470056 CTGCTGAAGCAGCAGGAAGATGG - Intronic
1165183410 19:33994018-33994040 TTTGAGGAGCATAAGGCAGAAGG - Intergenic
1165375961 19:35442174-35442196 TTAGAAAAGAAGAAGGAAGTTGG + Intergenic
1165468764 19:35990802-35990824 TAGGAGAAGGAGGAGGAAGGAGG + Intergenic
1165925645 19:39324531-39324553 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166158828 19:40936342-40936364 TTGCAGAAGAAGTTGGAAGAAGG - Intergenic
1166167765 19:41004247-41004269 TTGTAGAAGAAGTTGGAAGAAGG - Intronic
1166873326 19:45883635-45883657 TTGAAGGAGCAGAAGGGAGCGGG + Exonic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166886780 19:45966283-45966305 TTGGAGGAAGGGAAGGAAGAAGG - Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167591536 19:50406911-50406933 GTGGAGCAGGAGAAGGAAGTGGG - Intronic
1167608138 19:50492703-50492725 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167689811 19:50978397-50978419 TTGGAGGTGGAGAAGAAAGAGGG + Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168602429 19:57728437-57728459 TTGGAGTGGAAGAAGGAAGAGGG + Intronic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925078154 2:1037161-1037183 AGAGAGAAGCAGAAGGCAGATGG - Intronic
925097624 2:1219894-1219916 TTTCAGAAGAAGAAGGCAGATGG + Intronic
925482647 2:4293224-4293246 GTGGAGAAGGATAAGGATGAGGG - Intergenic
925639115 2:5970619-5970641 TTGGAGAGGCAGGAAGAATATGG - Intergenic
925839810 2:7980506-7980528 TGGGGGAGGCAGAAGGGAGATGG - Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925977624 2:9152127-9152149 TTAGAGAACCAGAAAGAATAGGG - Intergenic
926039954 2:9665077-9665099 TTGAATAGGCAGAAAGAAGAGGG - Intergenic
926434708 2:12826092-12826114 TTGGAGTAGCAGCATGAACAAGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926624961 2:15083299-15083321 GTGGAGATGGAGAGGGAAGAAGG - Intergenic
926724118 2:15984255-15984277 CTGGAGAAGCAAGAGGGAGAAGG - Intergenic
926841430 2:17084950-17084972 ATGGAGAAGTAGATGGGAGATGG - Intergenic
926846803 2:17150019-17150041 AGGGAGAAGCAGAGGGAAGCGGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926946219 2:18190236-18190258 TTGGAGCAGAATAAAGAAGATGG + Intronic
927002419 2:18811943-18811965 TTGGAGAAGTGGAGGGGAGAGGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927342063 2:21993595-21993617 TTGGAGAAACAGCAAGAAAAAGG - Intergenic
927499648 2:23574161-23574183 TTGGAGGAGGAGAGGGAAGAAGG + Intronic
927527265 2:23756610-23756632 TTTAAGAAGCAGCAGAAAGAGGG - Intronic
927587951 2:24326366-24326388 TGGAAGAAGCAGAATAAAGAAGG + Intronic
927667907 2:25044846-25044868 TCCCATAAGCAGAAGGAAGAAGG - Intronic
928874754 2:36024937-36024959 TTGAGGAAGCAAAAGGAAAAAGG + Intergenic
928893819 2:36238300-36238322 TTGGAAGAAGAGAAGGAAGATGG - Intergenic
929098227 2:38284337-38284359 TAGGAGAAAGAGAAGGTAGAAGG + Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
929628516 2:43434683-43434705 TGGGGGAACCAGAAGGGAGATGG - Intronic
929934136 2:46282065-46282087 ATGGGGAAGGAGAAGGAACAAGG + Intergenic
930307926 2:49699853-49699875 TTGGAGAAGCCTAAGAAGGATGG - Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930349695 2:50234805-50234827 TCGGAGATTCAGAAAGAAGAAGG + Intronic
930511389 2:52349727-52349749 GTGGAGGAGAGGAAGGAAGAAGG - Intergenic
930672944 2:54170737-54170759 TTGGATAGGCAAAAGGAAGGAGG + Intronic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931483678 2:62669056-62669078 AGGCAGAAGCAGAAGAAAGACGG - Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932078023 2:68684342-68684364 TTGGAAAAGAAGAAGTAAAAAGG + Intronic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
932182221 2:69657494-69657516 TTGGAGAATAAGTAGGATGATGG - Intronic
932427139 2:71645285-71645307 TTGGGGAGCCAGAAGGGAGATGG + Intronic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
933270760 2:80230564-80230586 TTGAAAAAGCAGACGGAAAAGGG + Intronic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
933656712 2:84894531-84894553 TTGAAGCAGAAGAAGGAAGTGGG - Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
933998168 2:87685169-87685191 ATAGGAAAGCAGAAGGAAGAAGG + Intergenic
934165908 2:89294119-89294141 TCAGAAAAGCAGGAGGAAGAGGG + Intergenic
934201369 2:89888337-89888359 TCAGAAAAGCAGGAGGAAGAGGG - Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934792149 2:97070478-97070500 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
934814473 2:97313231-97313253 GTAGGAAAGCAGAAGGAAGAAGG + Intergenic
934823220 2:97395252-97395274 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
935277184 2:101485097-101485119 TTGGAGAATGAAGAGGAAGATGG - Intergenic
935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG + Intergenic
936061950 2:109300650-109300672 ATGGAGAAGGAAGAGGAAGATGG - Intronic
936225314 2:110644153-110644175 TGGGAATACCAGAAGGAAGAAGG + Intronic
936295684 2:111265704-111265726 ATAGGAAAGCAGAAGGAAGAAGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936517406 2:113191095-113191117 TTCCAGATGCATAAGGAAGATGG + Intronic
936741044 2:115509026-115509048 TGGGAGCAGCACAAGGAAGGGGG + Intronic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937922719 2:127143225-127143247 TTGGAGGAGCAGAAGGATGGTGG - Intergenic
938267780 2:129941071-129941093 TAGGATAAGCTGTAGGAAGATGG + Intergenic
938408710 2:131046625-131046647 TTGGAGAACTAGAGGGCAGAGGG - Exonic
938504840 2:131868513-131868535 TTTGAGAAACAGAAGGACCAAGG - Intergenic
938655700 2:133430862-133430884 GTGGAGAGGGAGAAGGAAGGAGG + Intronic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
939052029 2:137318742-137318764 TTGGAAAAGCTGAAGGACAAAGG - Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
941186435 2:162325944-162325966 TTGGAGAGGCAAGAGTAAGACGG + Intronic
941695590 2:168547848-168547870 TAGTAGAAGCGGAATGAAGATGG + Intronic
941723149 2:168833671-168833693 TTGGAGAAGTAGAAAGAAGTAGG - Intronic
941849427 2:170164421-170164443 CTGGAGAGGCAAAGGGAAGAGGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942210187 2:173662424-173662446 TTAGAGCAGCAGAAGGAACTTGG - Intergenic
942260363 2:174154960-174154982 TTTGAAAGGCAGAAGTAAGAAGG - Intronic
942744846 2:179220378-179220400 TAGGAGCAGCAAAAGGAAAAAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942898421 2:181086154-181086176 TTGGATAAGAAGTATGAAGAAGG + Intergenic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943187618 2:184632768-184632790 TTGGGGTAGAAGAAGGAAAAGGG + Intronic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943696531 2:190941717-190941739 TTTGAGAAGGGGAAAGAAGAAGG + Intronic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944143113 2:196478276-196478298 TTGGACAGGCAGAAAGGAGAAGG + Intronic
944269487 2:197765176-197765198 AGGGAGAAGGAGTAGGAAGAGGG + Intronic
944503682 2:200388029-200388051 TTGAAGAAACAGAAGGATTATGG + Intronic
944534878 2:200698880-200698902 TGGGAGAATGAGAAGGATGAAGG + Intergenic
944579981 2:201124080-201124102 CTAGAGAAGCAGTAGAAAGAAGG + Intronic
944728355 2:202495285-202495307 TGGGGGAACCAGAAGGGAGATGG + Intronic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945460007 2:210095321-210095343 TTGGAGAAGAAGTAGAGAGAGGG - Intronic
945976897 2:216277923-216277945 TTGGAGCAGCAGACAGAAGAGGG - Intronic
945977656 2:216283297-216283319 GTGGAGAATCAGAGGGAAAAGGG - Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946311493 2:218884551-218884573 TCTGAGAAGTAGAAGGTAGAAGG - Intronic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947087795 2:226475154-226475176 TGGAAGCAGGAGAAGGAAGAAGG - Intergenic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947228978 2:227866494-227866516 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
947867416 2:233408847-233408869 TTAAAGAAGCAGGAGGAAGCAGG + Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948302190 2:236915734-236915756 TTGGAGAAATAGAAGGAATTTGG + Intergenic
948318762 2:237052309-237052331 TTTGACAGGCTGAAGGAAGAAGG + Intergenic
948331829 2:237174144-237174166 TTGAAAAAGCAGAAGAAAGCTGG - Intergenic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
948906533 2:240982285-240982307 TTGGACAAGCTGAAGGCAGAGGG + Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169456458 20:5756774-5756796 TTTGGGAAGCTGATGGAAGACGG - Intronic
1169718636 20:8647874-8647896 TTGGAGAAGCAGAAAAACAAGGG - Intronic
1170077585 20:12436620-12436642 TTGGTAAAGCAGAAGGAATCTGG + Intergenic
1170527127 20:17250056-17250078 TTGGGGAAGCTGAATAAAGAAGG - Intronic
1171271786 20:23823825-23823847 TATGAGAAGCAAAAGGAAGGAGG + Exonic
1171383147 20:24748280-24748302 TGGGAGCAGCAGAAGGAAACAGG + Intergenic
1171822667 20:29868392-29868414 ATGGAGAATCAGGAGAAAGAAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172239631 20:33403894-33403916 TTGGAGAAGTAAAAGTAAGCAGG - Intergenic
1172638791 20:36428485-36428507 TTGGAGAAGCTGGTGGAAGCTGG + Intronic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1172865108 20:38089903-38089925 TTGTACCAGCAGAAAGAAGAGGG + Exonic
1173074176 20:39800954-39800976 CTGGAGAACCAAAAGGAAGCAGG - Intergenic
1173244886 20:41329894-41329916 TTAAAGAAGGAGTAGGAAGAGGG - Intergenic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173468724 20:43305676-43305698 TTGGAGAAGAGTAAGGAAGAGGG + Intergenic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1173860604 20:46280830-46280852 TTGGAGAAGCTCTTGGAAGAGGG - Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175040577 20:56046458-56046480 TTAGAGACTCAGAAGAAAGAGGG + Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1175353449 20:58343208-58343230 TTGAACAAGGAGCAGGAAGATGG - Intronic
1175554657 20:59840977-59840999 ATGGAGCAGCACAACGAAGAAGG - Intronic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176215623 20:63946366-63946388 GTGGAGCAGGAGAAGGAAGCCGG - Intronic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1176671555 21:9739510-9739532 TGGGAGAAGAAGAAGAAAGAAGG + Intergenic
1177070641 21:16502345-16502367 TAGGAGAAGCTGAAGAAAAAGGG - Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1177264469 21:18765040-18765062 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1177388229 21:20434038-20434060 TTGGAGGAGAAGAAGAAATACGG - Intergenic
1177449561 21:21247910-21247932 TTGAAGAGAAAGAAGGAAGAAGG - Intronic
1177802945 21:25846374-25846396 TTGGAGCAGGAAAAGGAAGGAGG + Intergenic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1178056820 21:28808317-28808339 TTGGAAAAGAAGAAGAAAGTTGG - Intergenic
1178745265 21:35243448-35243470 GAGGAGATGGAGAAGGAAGAGGG - Intronic
1179038242 21:37778822-37778844 TTACAGAGGCAGAAGGAAGGAGG - Intronic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1179355307 21:40653296-40653318 TTGGAGCAGTAGAAAAAAGATGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180324387 22:11355928-11355950 TTGGAGAACCACGAGAAAGAAGG + Intergenic
1180642177 22:17307798-17307820 GGGGTGCAGCAGAAGGAAGAAGG + Intergenic
1181615623 22:24052239-24052261 AGGGAGAAGTAGAAGCAAGAGGG + Intronic
1181618004 22:24068188-24068210 TTGGGGAAGCAGGAGGGAGAAGG + Intronic
1182496515 22:30712195-30712217 TTGGAGAAGAAAGAGGAGGAGGG - Intronic
1182505293 22:30777883-30777905 TTGGAGGAGAGGGAGGAAGAAGG + Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183044739 22:35210816-35210838 CTACAGAAGCAGAAGGAAAATGG + Intergenic
1184931468 22:47684277-47684299 TTTGAGAAGCAGAAAAAATAAGG - Intergenic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
949134502 3:546733-546755 TTGGACAAGAAGAAGGAAAGGGG + Intergenic
949277298 3:2299470-2299492 TTGAAGATTCAGAAGAAAGAGGG - Intronic
949609940 3:5693636-5693658 TTTGAACAGCAGAAAGAAGATGG - Intergenic
949901832 3:8821522-8821544 ATGGAGGATGAGAAGGAAGAAGG - Intronic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
951547113 3:23837902-23837924 GTGGACAAGCAGAAAGAAAAGGG - Intronic
951685611 3:25340730-25340752 CTGGAGAACAAGAAGGAAGTAGG + Intronic
951865839 3:27306302-27306324 TTGGAGAGGTAGATGAAAGAGGG - Intronic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952541557 3:34372863-34372885 TGTGGGAAGAAGAAGGAAGATGG + Intergenic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
953239351 3:41134839-41134861 TTTGAAAAGCAGCAGCAAGAAGG + Intergenic
953363820 3:42324846-42324868 CTGGAGAAGCATAAGCAAGTGGG - Intergenic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
953764385 3:45725127-45725149 TTGCAAAAGGAGAAGGAAGTTGG - Intronic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
954736576 3:52712646-52712668 TGCGGGAACCAGAAGGAAGATGG + Intronic
954770652 3:52965149-52965171 TTTGAGCTGGAGAAGGAAGAGGG - Intronic
954841736 3:53517354-53517376 TTGAAGTTGCAGAAGGAAGGTGG + Intronic
954994507 3:54869355-54869377 TTAAAGAAGCAGAATTAAGAAGG + Intronic
955008615 3:54992948-54992970 TGGCTGAAGCAGGAGGAAGAGGG + Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
957058050 3:75459313-75459335 TGGGGGAGCCAGAAGGAAGATGG + Intergenic
957421778 3:79980468-79980490 TTGGAGAAGTAGTATGTAGATGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
958177005 3:90008713-90008735 TTGGAGAAGGAGATGGAAATTGG - Intergenic
958457784 3:94354298-94354320 TTAGAAATGAAGAAGGAAGAAGG + Intergenic
958717979 3:97809789-97809811 TTATAGAAGGAAAAGGAAGAAGG + Intergenic
958735093 3:97999889-97999911 GTGGAGAAGGTGAAGGAAGGAGG + Intronic
959133911 3:102392583-102392605 TGGCAGAAGAAGAAGAAAGAAGG - Intronic
959172306 3:102858162-102858184 TGTCAGAAGAAGAAGGAAGAAGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960062824 3:113340902-113340924 TGGGAGAACCAGAAGGGAGATGG + Intronic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960113383 3:113867886-113867908 TGGGAGTATCAGAAGGAAAAAGG - Intronic
960298072 3:115968227-115968249 TGAGAAAAGGAGAAGGAAGAGGG - Intronic
960414953 3:117373246-117373268 TTGGATACTCAGAAGGTAGAGGG - Intergenic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
960996899 3:123346185-123346207 TGGGAGAAGCAGCAGGGAAATGG + Intronic
961070993 3:123926701-123926723 TTGGAGAAGGAAAAGAAAGAGGG + Intronic
961153192 3:124657166-124657188 TTGGATTGGGAGAAGGAAGAGGG + Intronic
961295403 3:125880402-125880424 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962390009 3:134963181-134963203 GTACAGAAGAAGAAGGAAGAAGG - Intronic
962563086 3:136628552-136628574 TAGGAGAAGAAGAAGGGAGCAGG - Intronic
963350170 3:144141801-144141823 TTGGAGAAGCAGTGGGAACCAGG - Intergenic
963358809 3:144244542-144244564 TTGTGGAAGAAGAAGGAAGCAGG + Intergenic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
963646125 3:147917000-147917022 TAAGAGAAGAAGAAGGGAGAAGG - Intergenic
964086955 3:152830630-152830652 TGGGAGAGGGAGGAGGAAGAGGG - Intergenic
964366144 3:155952658-155952680 TTGGCAAAGAAGAGGGAAGATGG + Intergenic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
964877952 3:161390711-161390733 TAGGAGAACCAAAAGGAAAAAGG + Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
966211721 3:177460239-177460261 TGGGAGGAGGGGAAGGAAGAAGG + Intergenic
966319891 3:178690516-178690538 GAGGAGAATGAGAAGGAAGAAGG + Intronic
966440965 3:179943872-179943894 TGGGTAAAGCAGAAGGAAGCAGG + Intronic
968045207 3:195620075-195620097 TCGGAGGGACAGAAGGAAGAGGG - Intergenic
968061059 3:195726418-195726440 TCGGAGGGACAGAAGGAAGAGGG - Exonic
968077190 3:195822635-195822657 TTTGAGAAGCAGAAGCAATGAGG + Intergenic
968323870 3:197795145-197795167 TTGGGCAAGCAGAAACAAGAAGG + Intronic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969327459 4:6452160-6452182 TTTGACAAGCAGAAGGCAGTTGG - Intronic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
969995071 4:11303575-11303597 CGGGAGAAGAACAAGGAAGAAGG - Intergenic
970234486 4:13944768-13944790 TGGGGGAGTCAGAAGGAAGATGG + Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970276016 4:14402155-14402177 CTGCTGAAGCAGAAGGAAAAGGG + Intergenic
970553098 4:17203930-17203952 TGGAAAAATCAGAAGGAAGAGGG + Intergenic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
971075226 4:23140351-23140373 TTTGATAAGAAGAAGGTAGATGG - Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971342448 4:25782948-25782970 TGGGAGAAGCAGAAGCAGAAGGG + Intronic
971574091 4:28251884-28251906 GTGGAGAAAGAGAAGGAAGCTGG + Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972600800 4:40570612-40570634 TTCCTGAAGCAGAAGGAAAATGG + Intronic
972770620 4:42193877-42193899 TGGGTAAAGCAGAGGGAAGATGG + Intergenic
973189740 4:47373244-47373266 TGGAAGAAGCAGAAAGAAAAAGG - Intronic
973965077 4:56153516-56153538 TGGGAGAAACAGGAGGAAGGAGG - Intergenic
974239226 4:59223783-59223805 TTAGAGTAGCAGAAAGAAGGAGG - Intergenic
974247092 4:59333849-59333871 GTGGAAGAGCAGAAGGAAGGAGG - Intergenic
974468801 4:62292700-62292722 TTGCAAGGGCAGAAGGAAGAAGG - Intergenic
974533801 4:63148413-63148435 ACGGAGAAGGAGAAGGAAAAAGG - Intergenic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975814705 4:78205722-78205744 TGGGAGCAGCAGCAGGAAGAGGG + Intronic
976026029 4:80688700-80688722 TTTGAGAAGCTGAGAGAAGAAGG + Intronic
976205618 4:82620772-82620794 TTGGACAATGAGAAGGGAGATGG + Intergenic
976372814 4:84309668-84309690 TTGGAGATGGACAAGGAAGCAGG - Intergenic
976940174 4:90690574-90690596 TAGGAGAAGCAGAAGCCAAAAGG - Intronic
977183128 4:93902597-93902619 TGGCTGAAGCAGGAGGAAGAGGG - Intergenic
977434122 4:96971491-96971513 TAAGAGAAGCAGAAGGAATTAGG - Intergenic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978136406 4:105266785-105266807 TTGGAGTACCAGAAGGAGGTGGG + Intronic
978151671 4:105443332-105443354 GTGAAGAAGCAGAAGGCAGAAGG + Intronic
978194439 4:105954449-105954471 TTGGAGAATGAACAGGAAGAAGG - Intronic
978303648 4:107297839-107297861 TTGTAGAAGAAGAACAAAGATGG + Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978466045 4:109010640-109010662 TTGGAAAAAGAGAAGGCAGAAGG + Intronic
979041283 4:115799922-115799944 TTGGATAAGATCAAGGAAGAAGG - Intergenic
979117246 4:116841128-116841150 TTTGAGAATCAGATGGAAAATGG - Intergenic
979400789 4:120247038-120247060 GTGGATTTGCAGAAGGAAGAGGG + Intergenic
979757093 4:124354483-124354505 TTGAAGAAGAAGAAGAAAGTTGG - Intergenic
979808205 4:125001657-125001679 TTGGGGAGGCAAAAGGAAGATGG + Intergenic
979844346 4:125489877-125489899 TGGGAGAAGAAGAAGGAGTAAGG - Intronic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980297170 4:130936028-130936050 TTGGAAAGGAAGAAGAAAGACGG - Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981421841 4:144559611-144559633 GTGGAGAAGTAAAAGCAAGATGG + Intergenic
981460919 4:145012990-145013012 TTGGAGGAAGAGAGGGAAGAGGG - Intronic
981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG + Intronic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
982344692 4:154344644-154344666 TTGCAGAAACAGAAGGAAAAAGG + Intronic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983924457 4:173384617-173384639 TTAGAGAATTGGAAGGAAGATGG - Intergenic
984035097 4:174657407-174657429 TTGTATAAGGAGAAGGAAAAAGG + Intronic
984036298 4:174672377-174672399 TTGGAGAGGAAGAAAGAAAAAGG - Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984269542 4:177534208-177534230 CTGGAGAAGCAGGAGGGAGTAGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984957686 4:185061964-185061986 TTACAGAAGCAGAAAGCAGATGG + Intergenic
985679992 5:1250920-1250942 AAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985679994 5:1250943-1250965 GAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
986247449 5:6023242-6023264 ATGGAGAAGCAGCAGGGAAAAGG + Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
986643376 5:9893156-9893178 TTGTAGGGGAAGAAGGAAGAAGG - Intergenic
987182173 5:15379639-15379661 TTTGAAAGGCAGAAAGAAGAAGG + Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
987725868 5:21699093-21699115 TTTGTGAAGAACAAGGAAGAGGG - Intergenic
988169896 5:27639871-27639893 TAGGAGAAGAAGAAAGAAAAGGG - Intergenic
988776002 5:34478575-34478597 TTTGAGGGGCAGAAGGCAGAAGG + Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
989563756 5:42880372-42880394 TAGGAGGAGGGGAAGGAAGATGG - Intronic
989603377 5:43220849-43220871 TTGAAGAAGCCGAGAGAAGAAGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990143991 5:52738025-52738047 TGGGAGAAGAAGTAAGAAGAAGG - Intergenic
990182296 5:53174516-53174538 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
990349219 5:54899163-54899185 TTGAAGAAGCAGAAGGGAATGGG - Intergenic
990486155 5:56261093-56261115 TGTGAGAATGAGAAGGAAGAAGG - Intergenic
990517820 5:56546951-56546973 TAGGAGAGGCAAAGGGAAGAGGG - Intronic
991057297 5:62334527-62334549 TAGGAGAAGGAAGAGGAAGAGGG - Intronic
991230512 5:64328018-64328040 TTCCAGAAGGAGGAGGAAGAGGG + Intronic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992090649 5:73312971-73312993 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
992361264 5:76041039-76041061 TGGGAGGGGCAGAAGGGAGAGGG + Intergenic
992368379 5:76116465-76116487 TGGGAAGAGCAGAAGGCAGAGGG - Intronic
992376186 5:76190044-76190066 TGGTGGAAGCAGAAGGAAGATGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992802459 5:80305935-80305957 TTGGAAAAGGAGAATGAAGTAGG - Intergenic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
993975135 5:94470087-94470109 TTGGACAAGCACCAGGAATATGG + Intronic
994109653 5:95986945-95986967 TTGGAGTGGCAGAAAGGAGATGG + Intergenic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
995035147 5:107525709-107525731 GAGGAGAAGGAGAAAGAAGAGGG + Intronic
995749054 5:115434866-115434888 TGGGAGACGAAGCAGGAAGATGG + Intergenic
996053772 5:118962597-118962619 ATGGAGAAGAAAAAGGAAGTGGG + Intronic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
997251528 5:132392410-132392432 CTGGAGAAGCAAAGGAAAGAGGG - Intronic
998233108 5:140374235-140374257 TTGGAGAAGCATGAAGATGAGGG - Intronic
998679883 5:144455236-144455258 ATGTGGAAGCAGAAGGAAGTTGG - Intronic
998855175 5:146387733-146387755 TTTGAGGAGAAGAAGGAAGGAGG - Intergenic
999064987 5:148676006-148676028 TGTGAGAAGCAGAAGGAAATCGG - Intronic
999189405 5:149735376-149735398 TTCCAGAGGAAGAAGGAAGAGGG - Intronic
999216367 5:149938997-149939019 TGGGTGAAGGAGAAGGAAGGTGG - Intronic
999297985 5:150472562-150472584 TGGGAGAAGCTGAGGGAAGCAGG - Intergenic
999397597 5:151239919-151239941 TTGGAGGGGCAAAAGGAAGAGGG + Intronic
999443895 5:151623516-151623538 TTGGGGAAGCTGAAGCAAGAGGG + Intergenic
999493023 5:152070339-152070361 TTGAAAAAACAGAAGGAAGCAGG - Intergenic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000167923 5:158673260-158673282 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1000334551 5:160232313-160232335 TTTGAGAAGGAGAAGTCAGATGG - Intronic
1000497717 5:162006439-162006461 TTGGAATAGCTGAAGGAAAATGG + Intergenic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1001033762 5:168281976-168281998 TTGGAGATGTAGAAGAAAGGAGG + Intergenic
1001041908 5:168342225-168342247 TTGGAGCAGAGGAAGGGAGAGGG + Intronic
1001196309 5:169676371-169676393 TGGGAGAAAAAGAAGAAAGAGGG + Intronic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1001767032 5:174257910-174257932 TTGGACAAGAGCAAGGAAGAAGG - Intergenic
1001857064 5:175022114-175022136 TTTGAGAAACAGAAAGAAGCGGG + Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1001906192 5:175475644-175475666 TGGGAAAAGCAGATGGATGAAGG - Intergenic
1002002555 5:176206272-176206294 TGGTGAAAGCAGAAGGAAGAGGG + Intergenic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002408680 5:179056007-179056029 TTGCTGAAGCAGAAAGAAAAGGG - Intergenic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002797678 6:488028-488050 TTAGAGAAGCAGCAAGAAAAAGG + Intronic
1002865648 6:1119858-1119880 TTGGTGAATCAGAACAAAGAAGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003268251 6:4585457-4585479 TGGGAGAAGAAGAGGGGAGAAGG - Intergenic
1003395747 6:5750578-5750600 TTGCAGGTGCAGGAGGAAGAAGG + Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003604411 6:7545989-7546011 TTGGATAGGCAGAGGGAAGCTGG + Intronic
1003736078 6:8878964-8878986 AGGGAGAAGCAAAAGGAACACGG - Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004167124 6:13266677-13266699 TTGGAGGAGCAGGAGCAAGAGGG + Exonic
1004417249 6:15436295-15436317 TGGGAGAGCCAGAAGGGAGATGG + Intronic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1004581500 6:16958623-16958645 TAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1005558781 6:27015981-27016003 TTGAAGCAGCACAAGGCAGATGG - Intergenic
1005622012 6:27628876-27628898 TGGGGGAAGGAGAAAGAAGAGGG + Intergenic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006808331 6:36803349-36803371 TTAGAGATGCAGGAGGATGATGG - Intronic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1007129377 6:39455527-39455549 TTTGACGAGCTGAAGGAAGAAGG + Intronic
1007361189 6:41357408-41357430 TGGGATAAGCAAAAGGTAGATGG + Intergenic
1007694910 6:43725769-43725791 TGGGAGAAGCAGAACGGGGAAGG + Intergenic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1008664336 6:53701243-53701265 TAGCAGAAGCAGAAGCATGAAGG - Intergenic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010630023 6:78188452-78188474 TGGCAGGAGCAAAAGGAAGAGGG + Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1011253822 6:85401346-85401368 TTTAAGAAGCAGAAGAGAGAGGG + Intergenic
1011753117 6:90473103-90473125 TGGGCTGAGCAGAAGGAAGAGGG - Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1011888420 6:92126674-92126696 GAGGAGGAGCAGGAGGAAGAGGG + Intergenic
1012072434 6:94639908-94639930 TGGGGGAGCCAGAAGGAAGATGG - Intergenic
1012232525 6:96777215-96777237 AAGGAGAAGGAGAAGAAAGAGGG - Intergenic
1012333429 6:98023075-98023097 AAGGAGATGCAGAAGGAATATGG - Intergenic
1012440198 6:99255180-99255202 TGGGGGAGGCAGAAGGGAGACGG - Intergenic
1012708996 6:102573522-102573544 TTCGAGGAGGAGAAAGAAGAGGG - Intergenic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1014489649 6:122046065-122046087 TTGCAGAAGAAAAAGGAAGCTGG + Intergenic
1014528047 6:122524115-122524137 AAGGAGGAGGAGAAGGAAGAAGG - Intronic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015180398 6:130355744-130355766 ATGGAGAAGCACCAGTAAGAGGG + Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015225509 6:130852776-130852798 ATGGAGATGCAGGAGGAAGGAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015547866 6:134379991-134380013 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1015585591 6:134772824-134772846 TAGCAAAAGCAGAAGCAAGATGG - Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015837048 6:137431699-137431721 TTGCAAAAGGAGAAGGAATAGGG + Intergenic
1015983733 6:138865034-138865056 TCGCAGAAGTAGATGGAAGAGGG - Exonic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016290618 6:142525132-142525154 TAGGAAAAGGAAAAGGAAGAAGG - Intergenic
1016466107 6:144327203-144327225 TGGGAGGAGGAGAAGGAGGAGGG + Intronic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1016708728 6:147144450-147144472 TTGGGGAAACAGTAGGAATAAGG + Intergenic
1016794723 6:148105753-148105775 ATGGAGGAGAAGGAGGAAGATGG + Intergenic
1016927446 6:149365717-149365739 TTGGAGATTCAGAAGGAAAGGGG - Intronic
1017237323 6:152130172-152130194 TAGGATAAGCAGAAGAGAGAAGG + Intronic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017297357 6:152813614-152813636 TTGGATAAGCAAAAGGATGCTGG + Intergenic
1017359879 6:153555353-153555375 TTGGAGAAGGAAAAGGAAACTGG - Intergenic
1017805174 6:157939635-157939657 TGGGAGAAAGAGAAGGATGAGGG + Intronic
1017853553 6:158328169-158328191 TTGGAGGAGCAGGAGGAGGGAGG + Intronic
1018282780 6:162206027-162206049 CGAGAGAAGGAGAAGGAAGAAGG + Intronic
1018333879 6:162763300-162763322 CTTGAGAAGCAGCAGGAAGGAGG + Intronic
1018399778 6:163411414-163411436 TGGGGTAAGCAGATGGAAGAAGG + Intergenic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1018945398 6:168344394-168344416 TTGGAGACGGAGGAAGAAGATGG - Intergenic
1019057022 6:169231362-169231384 TGGGAGAAGCAGAGGGAGCACGG + Intronic
1019113373 6:169736930-169736952 TTGGAGTAGCAGAAGGAGATGGG - Intergenic
1019324718 7:432476-432498 TGGGAAACGCAGGAGGAAGATGG - Intergenic
1019412727 7:913592-913614 TTTGAGCAACAAAAGGAAGATGG - Intronic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1019830276 7:3321683-3321705 GAGGAGGAGGAGAAGGAAGAAGG - Intronic
1020011330 7:4807462-4807484 GGGGAGAAGGAGAGGGAAGAAGG - Intronic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020462691 7:8442561-8442583 TTGTAGAAGACGAAGGAAAATGG - Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1021138451 7:16993944-16993966 TTGGAGAAGGAGAAGAACAATGG - Intergenic
1021295909 7:18905799-18905821 TTGATGAGGGAGAAGGAAGAAGG - Intronic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1021972696 7:25981176-25981198 TGGAAGAAGGAGAAGGGAGAGGG + Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022577498 7:31512098-31512120 TTAGAGAAGGCTAAGGAAGATGG + Intergenic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1022651948 7:32285680-32285702 AGGGAGAAGAAGAAGAAAGAAGG + Intronic
1022845744 7:34207998-34208020 TTTAAGAAACAGAGGGAAGATGG + Intergenic
1023144155 7:37132625-37132647 TGGGTGGAGCAGAAGGAAGTGGG - Intronic
1023370276 7:39506124-39506146 TTGGAGACGGGGAAGGAAAAGGG - Intergenic
1023570816 7:41569617-41569639 CTCTAGAAGCAGAAGCAAGAAGG + Intergenic
1023595221 7:41822608-41822630 TTGGAAAAACAGAATGAAAAGGG - Intergenic
1023802014 7:43843386-43843408 TTGGCAAAGCAAAGGGAAGATGG - Intergenic
1024798767 7:53051293-53051315 TTGGTGAAGCTGAAAGAAGCTGG - Intergenic
1025245437 7:57313197-57313219 TTTGGGAACCAGAAGGAAGCGGG - Intergenic
1026098662 7:67367009-67367031 TTAGAGATGCAGAAGGTAGAAGG + Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026553872 7:71389703-71389725 TTGGAGAAGGACAACAAAGATGG - Intronic
1026584293 7:71643692-71643714 TTGCAGCAGCAGAAGGCAGCAGG + Intronic
1026679851 7:72457602-72457624 TGGGAGAAGGAGGAGGAAGAGGG - Intergenic
1026849701 7:73717181-73717203 GGGGAGAAGGAGAAAGAAGAGGG + Intronic
1027226219 7:76245258-76245280 TTGAAGGAGCAGAGGGAAGCAGG + Intronic
1027409625 7:77901378-77901400 TTTGGGAAGCTGAAGGCAGAAGG + Intronic
1027479363 7:78675779-78675801 TTGGAAAACAAGAAGGATGATGG - Intronic
1027639365 7:80714127-80714149 TTTGACGAGCAGAAAGAAGAAGG + Intergenic
1027656825 7:80940734-80940756 TGGAAAAAGCAGAAGAAAGAAGG + Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1028076851 7:86527094-86527116 TTGGACCAGCAGAAGGATGGAGG - Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029173915 7:98650381-98650403 TTGGAGCATCAGAAGGGAGAAGG + Intergenic
1029797584 7:102911150-102911172 TTGGAGGAGGTGAAGCAAGATGG - Intronic
1029930580 7:104366287-104366309 TTTGAGAAGATGGAGGAAGAGGG + Intronic
1029957510 7:104655031-104655053 TTGGACTAGCTGAAGGAAGAAGG - Intronic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1030417080 7:109258580-109258602 TTGGACAAATAGAAGGATGAAGG - Intergenic
1030522203 7:110611739-110611761 TAGGAGGGGCAGAAGGAAGAGGG + Intergenic
1030715769 7:112805154-112805176 TTGGATAAGCAGGAGGAAAGGGG - Intergenic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031219441 7:118945920-118945942 TGGGAGAGGCAGAAGGGAGATGG - Intergenic
1031610642 7:123822714-123822736 TTTGAGAAGCTGAGGGATGAAGG + Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031949459 7:127877278-127877300 TTAGCAAAGGAGAAGGAAGAAGG - Intronic
1032133390 7:129250485-129250507 TTGGACAAGAAGAAGTAAAATGG - Intronic
1032473952 7:132199733-132199755 TGGGGGAAGCAGAAGGAACTAGG + Intronic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1032817993 7:135496705-135496727 TAGGAGAGGTAAAAGGAAGATGG - Intronic
1033451139 7:141463273-141463295 TTCCAGAACCAGCAGGAAGAGGG + Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034016748 7:147596020-147596042 TTGGAGCTGCAGCATGAAGACGG - Intronic
1034071868 7:148193910-148193932 TTGAACAAGCAGAAGGAAACGGG - Intronic
1034453418 7:151150034-151150056 TGGGAGGAGGAGGAGGAAGAGGG + Intronic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035419667 7:158717150-158717172 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419682 7:158717224-158717246 TAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1035419693 7:158717283-158717305 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035419753 7:158717611-158717633 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419768 7:158717685-158717707 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1036726372 8:11224451-11224473 TGGCTGAAGCAGGAGGAAGAGGG + Intergenic
1036783212 8:11664785-11664807 TTAGAGACTCAGAAGAAAGAGGG - Intergenic
1037229967 8:16646176-16646198 TTCCAGAAGCAAAAGGAAGAGGG + Intergenic
1037244781 8:16821260-16821282 TTGTAGAAACAGAATGCAGAAGG + Intergenic
1037300254 8:17444021-17444043 GAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037626206 8:20609263-20609285 TTTGAGAAGGTGAAGGAAAATGG + Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038913304 8:31991757-31991779 TTGGGGAAGGAGGAGGGAGAAGG - Intronic
1039293688 8:36126559-36126581 TTGGAGTACCAGAAGGAGGTGGG - Intergenic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041321526 8:56618740-56618762 TCTGAGAGACAGAAGGAAGAAGG - Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1041861870 8:62523616-62523638 TAGGAGCAGGAGAAGGAAAATGG + Intronic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1042215275 8:66424952-66424974 CTAGAGGAGCAGGAGGAAGATGG + Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042811908 8:72834950-72834972 TTGGAAAACCAGCAGGAGGAAGG + Intronic
1042889339 8:73589985-73590007 AGGGAGGAGGAGAAGGAAGAGGG + Intronic
1042938622 8:74085575-74085597 TTGGAAAAGCAGAAAGGAGCTGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043591580 8:81839983-81840005 TTGGAAAAGCCAAAAGAAGATGG - Exonic
1044584469 8:93856717-93856739 TTAGATAAACAGAAGGTAGAAGG - Intergenic
1044656920 8:94557938-94557960 TTGGAAAAGAAAAGGGAAGATGG + Intergenic
1044725104 8:95188300-95188322 GTGGAGAAGCAGAAGGCAGCAGG + Intergenic
1044822293 8:96162436-96162458 ATGAAAAAGCAAAAGGAAGAAGG - Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045326387 8:101120718-101120740 TTTGAGAAGCAAAATGAAAAAGG - Intergenic
1045837031 8:106534812-106534834 TTAAAGAAGCAGAAAGAAAATGG + Intronic
1046155030 8:110277276-110277298 TTGGAGAGGCAGAGGTAAAATGG + Intergenic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1046744767 8:117864895-117864917 TTGGAGAAGAGGAAGGAAGTAGG - Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1047640903 8:126820878-126820900 TTGGAGAGGAAGAAGGGAGATGG + Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1048135036 8:131740118-131740140 TGGGAGAGCCAGAAGGGAGATGG - Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048464936 8:134657641-134657663 TCAGAGAAGCACATGGAAGAAGG - Exonic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049058446 8:140257386-140257408 GAGGAGAAGTAGAAGGAAGGTGG - Intronic
1049133062 8:140866456-140866478 TTAGAGAAGCATAAGGAACATGG + Intronic
1049698719 8:143996776-143996798 TTGGGGAAGCAGGTAGAAGAAGG + Intronic
1049733292 8:144190144-144190166 ATGCAGAGGCAGGAGGAAGATGG - Intronic
1050435662 9:5607228-5607250 TTGGAGAAGAACAAGGTAGGAGG + Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1051027204 9:12626931-12626953 TTGCACATGCAAAAGGAAGAAGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053564444 9:39233714-39233736 TTGCAAAGGCAGAAGCAAGATGG + Intronic
1053750017 9:41243742-41243764 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1053830226 9:42071616-42071638 TTGCAAAGGCAGAAGCAAGATGG + Intronic
1054132706 9:61385322-61385344 TTGCAAAGGCAGAAGCAAGATGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054255516 9:62808080-62808102 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054335789 9:63807528-63807550 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1054600333 9:67115839-67115861 TTGCAAAGGCAGAAGCAAGATGG - Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054741961 9:68815318-68815340 TTTAAGAATCAGAAGAAAGAAGG + Intronic
1055378040 9:75671798-75671820 TTGAAGAAGAAGAGGGAAGGGGG + Intergenic
1055511035 9:76995791-76995813 TGGAAGGAGCAGAAGGAAGGGGG - Intergenic
1055862409 9:80768406-80768428 TCAGAGAGTCAGAAGGAAGACGG + Intergenic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1055984563 9:82043932-82043954 TTGGAAAAGAAGAAGTAAAACGG - Intergenic
1056253544 9:84775018-84775040 TTTGAAAAGCACAAGAAAGAAGG - Intronic
1056300267 9:85232974-85232996 TTTGAAAAGCAGAAGAAATATGG - Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1057779137 9:98035563-98035585 TTGGGGAAGCAGAAAGTAGGTGG + Intergenic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058363760 9:104182989-104183011 CTGGAGATGCAGAAACAAGAAGG + Intergenic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059259398 9:112961500-112961522 TGGGAGAAGCAGGAGGTAGAGGG - Intergenic
1059510184 9:114837897-114837919 TTGGTGAAGAAGAAAGATGAGGG - Intergenic
1060036640 9:120261534-120261556 CTGGAGAGGGAGAAGGCAGAGGG + Intergenic
1060204602 9:121675112-121675134 TTGGCGACTCAGCAGGAAGATGG - Intronic
1060290716 9:122300056-122300078 GTGGAGAAAGGGAAGGAAGAGGG + Intronic
1060675880 9:125514154-125514176 TAGGTGAAGAAGAGGGAAGAGGG - Intronic
1061201175 9:129139371-129139393 TTGAGGCAGCAGAAGGAACAGGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062477521 9:136736121-136736143 GGGGAGGAGAAGAAGGAAGAAGG - Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1203375716 Un_KI270442v1:374937-374959 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1185942695 X:4339133-4339155 TTGGAGAGGCAGATTGAATATGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186299835 X:8188194-8188216 AAGGAGAAGGAGTAGGAAGATGG + Intergenic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471169 X:9823113-9823135 AGGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186582956 X:10840624-10840646 TTGGAGAAAGAGAAGGAAGGCGG - Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1186919497 X:14262513-14262535 TTTGGGTAGAAGAAGGAAGAGGG - Intergenic
1187424960 X:19168985-19169007 TTTGAGAGTCAGAGGGAAGAGGG - Intergenic
1187552406 X:20319091-20319113 GTCTAGAAGCAGAAGAAAGAGGG + Intergenic
1187575957 X:20555547-20555569 TTGGAAAAGAAGAACAAAGAGGG + Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1187850083 X:23583104-23583126 TTTGGGTAGAAGAAGGAAGAGGG + Intergenic
1188079421 X:25817980-25818002 TGAGAAAAGCAAAAGGAAGAGGG - Intergenic
1188158113 X:26767124-26767146 TTGGAGATGCAGAAGCATGGGGG + Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188581874 X:31723759-31723781 TTTGAAAAGCAGAAGGAAGCTGG - Intronic
1189052660 X:37663046-37663068 TGAGAGATGTAGAAGGAAGAAGG - Intronic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1189959065 X:46307555-46307577 TGGGAGAGCCAGAAGGGAGATGG + Intergenic
1190718389 X:53124577-53124599 ATGGAGAAGCAGGAGTTAGAGGG - Intergenic
1191696279 X:63994071-63994093 TTGAGGAAGCAGGAGGAAAAGGG + Intergenic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1191899078 X:66022615-66022637 TTCTGGAAGCAGAAGGCAGATGG + Intronic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192550718 X:72051570-72051592 TAGGAGAAGCAAGAGGAAGGAGG - Intergenic
1192639059 X:72846070-72846092 TGGGAGATGGAGGAGGAAGAGGG + Intronic
1192642653 X:72874738-72874760 TGGGAGATGGAGGAGGAAGAGGG - Intronic
1192793429 X:74406561-74406583 TGGCAAAAGCAGGAGGAAGAGGG + Intergenic
1192890289 X:75383475-75383497 GTGCAGAAGCAGAAGGTATAAGG - Intronic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193405491 X:81096014-81096036 TTGGAGATGCAGAAGGGGTAAGG + Intergenic
1193416378 X:81229529-81229551 TTGGGGAGCCAGAAGGGAGATGG + Intronic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193817431 X:86121188-86121210 TTGAACAAGCAGAAAAAAGAAGG - Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194737196 X:97526599-97526621 TTAGAGATGGAGAAGGTAGAAGG - Intronic
1195038059 X:100988179-100988201 GTGGAGAAGCTGGTGGAAGATGG - Exonic
1196072302 X:111539336-111539358 TGGGGGAACCAGAAGGGAGATGG - Intergenic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196731105 X:118942311-118942333 AAGGAGAAGGAGAAGAAAGAAGG + Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197228723 X:123980045-123980067 TTTGAGAAGCAGAAACAAAAAGG - Intronic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197795216 X:130291075-130291097 TTGGGGAAGAAAGAGGAAGATGG - Intergenic
1197815466 X:130493757-130493779 TTGGAAAAGAAGCAGTAAGATGG + Intergenic
1197903777 X:131401367-131401389 TGGGAGAGGGAGGAGGAAGATGG + Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199059817 X:143341641-143341663 TTCAAAATGCAGAAGGAAGATGG - Intergenic
1199090354 X:143684365-143684387 TAGGAGAGGGAAAAGGAAGAAGG + Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199714303 X:150495426-150495448 TTGGATATGCAGAAGAAATATGG + Intronic
1199991398 X:152989577-152989599 AAGGAGGAGCAGGAGGAAGAGGG - Exonic
1200010001 X:153113745-153113767 TTTGAGAACCAGAAGGGGGAAGG - Intergenic
1200029599 X:153286177-153286199 TTTGAGAACCAGAAGGGGGAAGG + Intergenic
1200105699 X:153710865-153710887 ATCGGGGAGCAGAAGGAAGAGGG - Intronic
1200123428 X:153802092-153802114 TTGGGGTGGGAGAAGGAAGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200592778 Y:5097643-5097665 TTGGGGAAAGAGAAGGAAGGTGG + Intronic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1200960203 Y:8989482-8989504 ATGGAGAGCCAGAAGGGAGATGG - Intergenic
1201066313 Y:10098629-10098651 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1201316896 Y:12656271-12656293 TTGGGGGAACAGAAGGAATAAGG - Intergenic
1201442290 Y:14021305-14021327 TTTGAGAAGCAGAACAAACATGG - Intergenic