ID: 903050020

View in Genome Browser
Species Human (GRCh38)
Location 1:20593816-20593838
Sequence CTGTGTGAGGCCAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261804
Summary {0: 1, 1: 387, 2: 24259, 3: 78013, 4: 159144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903050020_903050027 -8 Left 903050020 1:20593816-20593838 CCTCCCACCTTGGCCTCACACAG 0: 1
1: 387
2: 24259
3: 78013
4: 159144
Right 903050027 1:20593831-20593853 TCACACAGTACTGGGATTACAGG 0: 1
1: 162
2: 13749
3: 331713
4: 265712
903050020_903050028 11 Left 903050020 1:20593816-20593838 CCTCCCACCTTGGCCTCACACAG 0: 1
1: 387
2: 24259
3: 78013
4: 159144
Right 903050028 1:20593850-20593872 CAGGCATGAGCCACTGCACCTGG 0: 6440
1: 26478
2: 70922
3: 127775
4: 147131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903050020 Original CRISPR CTGTGTGAGGCCAAGGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr