ID: 903050141

View in Genome Browser
Species Human (GRCh38)
Location 1:20594538-20594560
Sequence GGTGCTTTTGGAGGCCGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9442
Summary {0: 1, 1: 0, 2: 25, 3: 639, 4: 8777}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903050135_903050141 7 Left 903050135 1:20594508-20594530 CCAGGCGCGGTGGCTCATGACTG 0: 63
1: 7691
2: 58598
3: 125207
4: 167419
Right 903050141 1:20594538-20594560 GGTGCTTTTGGAGGCCGAGCTGG 0: 1
1: 0
2: 25
3: 639
4: 8777

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903050141 Original CRISPR GGTGCTTTTGGAGGCCGAGC TGG Intronic
Too many off-targets to display for this crispr