ID: 903050770

View in Genome Browser
Species Human (GRCh38)
Location 1:20599229-20599251
Sequence CAACAGGTCTAGAGAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903050768_903050770 0 Left 903050768 1:20599206-20599228 CCTGAGGGGAGCAGCTGGAAGGA 0: 1
1: 1
2: 0
3: 36
4: 351
Right 903050770 1:20599229-20599251 CAACAGGTCTAGAGAACAAAAGG 0: 1
1: 0
2: 4
3: 15
4: 190
903050766_903050770 1 Left 903050766 1:20599205-20599227 CCCTGAGGGGAGCAGCTGGAAGG 0: 1
1: 0
2: 5
3: 39
4: 316
Right 903050770 1:20599229-20599251 CAACAGGTCTAGAGAACAAAAGG 0: 1
1: 0
2: 4
3: 15
4: 190
903050760_903050770 25 Left 903050760 1:20599181-20599203 CCCTGTGGCAGGAGCATACTGGT 0: 1
1: 0
2: 3
3: 19
4: 183
Right 903050770 1:20599229-20599251 CAACAGGTCTAGAGAACAAAAGG 0: 1
1: 0
2: 4
3: 15
4: 190
903050761_903050770 24 Left 903050761 1:20599182-20599204 CCTGTGGCAGGAGCATACTGGTG 0: 1
1: 0
2: 0
3: 14
4: 132
Right 903050770 1:20599229-20599251 CAACAGGTCTAGAGAACAAAAGG 0: 1
1: 0
2: 4
3: 15
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903050770 Original CRISPR CAACAGGTCTAGAGAACAAA AGG Intronic
903050770 1:20599229-20599251 CAACAGGTCTAGAGAACAAAAGG + Intronic
904715132 1:32462120-32462142 CAACAGATCTAGAGATCATAAGG + Intergenic
907179289 1:52554950-52554972 CAACAGGTCTTATTAACAAAGGG + Intergenic
909505832 1:76388706-76388728 CCACAGAGCTAGAGAACAAATGG - Intronic
910282409 1:85515896-85515918 TCACAGTTCTAGAGAACAGACGG + Intronic
914207682 1:145547994-145548016 TCACAGTTCTAGAGAACAGAAGG - Intergenic
917911428 1:179651008-179651030 CATCATGTCTTGAGAACAGAGGG + Exonic
918771718 1:188569204-188569226 AAACATGTTGAGAGAACAAAAGG + Intergenic
919248471 1:195020018-195020040 TCACAGGTCTGGAGAATAAAAGG + Intergenic
919299750 1:195744667-195744689 CTACAGGTCTAACTAACAAAAGG - Intergenic
921833273 1:219751737-219751759 CTCCAGGTTTGGAGAACAAATGG + Intronic
921979180 1:221236428-221236450 CAGGATTTCTAGAGAACAAAAGG - Intergenic
923854446 1:237830515-237830537 CATTTGGTCTAGAAAACAAAGGG - Exonic
924626951 1:245703499-245703521 CAAACGGTCTACAGAACATACGG - Intronic
1064434082 10:15295634-15295656 CAACAGCTCTAAAAACCAAAAGG - Intronic
1065494680 10:26316117-26316139 CAAAAGGTCGAGAGAAAGAAAGG + Intergenic
1068529541 10:58169452-58169474 CTACAAGTCTACAGAATAAAAGG + Intergenic
1071494200 10:86156524-86156546 CTACAGGTGAAGAAAACAAAGGG + Intronic
1071707250 10:88012450-88012472 CACCTGGGCTAGGGAACAAATGG + Intergenic
1076407780 10:130224690-130224712 GAAGAGCTCTAAAGAACAAAAGG - Intergenic
1077875906 11:6305377-6305399 CAACTGGTCTAGAGAAAAGAGGG + Intergenic
1080778536 11:35408683-35408705 CCACTGGTCCAGAGGACAAAAGG + Intronic
1081030190 11:38070940-38070962 GAACAGCACTAGAGACCAAATGG - Intergenic
1084525040 11:69691821-69691843 CAATATGTCCAGAAAACAAAGGG - Intergenic
1085193342 11:74648518-74648540 AAACAGGTCTTGAGAAAAATAGG + Intronic
1087552751 11:99672789-99672811 AAACAGGTCTAAAGAAAGAATGG - Intronic
1087677526 11:101180123-101180145 CCACAGGGCTAGAGCAAAAATGG - Intergenic
1087726621 11:101725499-101725521 GAAGAGGTTTAGAGAAGAAATGG - Intronic
1087823283 11:102735631-102735653 CAACAGTTATAAAGATCAAAAGG - Intergenic
1089689264 11:120176851-120176873 CAAGAGGTCTGGAGAAGAATGGG - Intronic
1092212171 12:6653460-6653482 GAAAAGGTCCAAAGAACAAAAGG - Intronic
1092810068 12:12264514-12264536 CAACAGGGCTACAGGACAGAAGG + Intronic
1093716090 12:22383667-22383689 CAAGATGTATAGAAAACAAATGG + Intronic
1096802324 12:54119141-54119163 CAAGATGTCTAGAGAATAAGAGG + Intergenic
1097278213 12:57827407-57827429 CAACAAGTATGGGGAACAAATGG + Intronic
1098226369 12:68329321-68329343 AATTTGGTCTAGAGAACAAAGGG - Intronic
1099092279 12:78327460-78327482 CAACAGGTATATTGCACAAATGG - Intergenic
1100903643 12:99272761-99272783 CAAATGGTCTAGAGAAGAAAGGG - Intronic
1101087670 12:101253035-101253057 CAACAGGACAGGAAAACAAAAGG - Intergenic
1102051596 12:109866110-109866132 CAACAGCCCTACAGAACAATGGG + Intronic
1104798587 12:131537264-131537286 CAAAAAGTCTAGGGAACAGAGGG + Intergenic
1106738313 13:32611314-32611336 CAACAGGCATAGAGAAGAGAAGG - Intronic
1106822347 13:33479041-33479063 CAACAGCTCTATAGAAAAATGGG + Intergenic
1107199391 13:37695542-37695564 CAACAACTCTAGAGAAAGAACGG - Intronic
1108252721 13:48583035-48583057 CCACACGTCTAAAGAACAACAGG + Intergenic
1108836157 13:54552067-54552089 CAACAAGTCCAGAGAACAACAGG - Intergenic
1109280238 13:60348056-60348078 GAACAGGCCTTGAAAACAAAAGG + Intergenic
1109310823 13:60691010-60691032 CAACAGGTTTAGAAAACTCAGGG - Intergenic
1109338894 13:61029013-61029035 CATCACATCGAGAGAACAAAGGG + Intergenic
1111162358 13:84412164-84412186 CTACAGGTATAGATAACAATTGG + Intergenic
1112249079 13:97762374-97762396 AACCATGTCTAGAGAACTAAAGG + Intergenic
1112814856 13:103261347-103261369 AAACAGCTCTACAGACCAAATGG - Intergenic
1115859908 14:37673117-37673139 CAACAGGTCTATGGAATACAGGG + Intronic
1117093312 14:52271666-52271688 TAAAAGGTCTAGAAAACACAAGG + Intronic
1117118860 14:52547540-52547562 CAACTGGCCTAGAGAACTCAGGG + Intronic
1117281415 14:54245006-54245028 TAACAGGACTAGAGAACTATAGG + Intergenic
1117496363 14:56309408-56309430 CAAGAGGTTAAGAGAGCAAAAGG - Intergenic
1118010782 14:61608372-61608394 CAACTGGCCCAGAGAACTAACGG + Intronic
1118618584 14:67594088-67594110 AAACAGATCCAGACAACAAATGG + Intronic
1120106235 14:80498523-80498545 CAAAAGCTCCAGAGAAGAAAGGG - Intronic
1120330740 14:83090322-83090344 CAGCAGGTCTAAAGGACAGAGGG + Intergenic
1120376908 14:83719905-83719927 CAAAAGTTATAGAGAAAAAATGG - Intergenic
1125995758 15:44159332-44159354 CAACAGGGCTAGACCATAAAGGG + Intronic
1126913215 15:53436854-53436876 CACCAGGTGGAGAGAACACATGG - Intergenic
1128747905 15:70127416-70127438 CAGAAGGTCTAGAGTTCAAAAGG + Intergenic
1134118702 16:11568581-11568603 CAACAGGTGTGGAGAAGAAAGGG + Intronic
1135947121 16:26875043-26875065 CATCAGGTCTAGGGGACAATAGG - Intergenic
1136635952 16:31523401-31523423 CTACAGGTAAATAGAACAAATGG - Intergenic
1137354091 16:47742262-47742284 CACCATGTCTAAAGACCAAAAGG - Intergenic
1137571378 16:49568446-49568468 CAGCTGGTCTAGGGAACAAGGGG - Intronic
1139682664 16:68577365-68577387 AACCATGTCTAGAGAACTAAAGG + Intergenic
1140239503 16:73188443-73188465 CATCAGCTCGAGAGGACAAAGGG - Intergenic
1140523288 16:75600782-75600804 CAATATGTCTGAAGAACAAAGGG - Intronic
1141346960 16:83255628-83255650 CAACAGGTCTAGATGCCAAGAGG - Intronic
1144210916 17:13014812-13014834 CAACTTGTCTAGAGAAGAAGAGG + Intronic
1146615692 17:34355713-34355735 CAACAGCTCTAGAAACCCAATGG + Intergenic
1150992553 17:70276675-70276697 TAACAGGTCCATAGAACAGAAGG - Intergenic
1153173767 18:2346997-2347019 CAACAAGGCAAGAGAACAACTGG + Intergenic
1157685678 18:49640701-49640723 CAGCCTGTCTTGAGAACAAAGGG - Intergenic
1157836258 18:50906083-50906105 CACCATGTCTAAAGAACTAAAGG - Intronic
1158380187 18:56921141-56921163 CAACAAGGCTAGAAATCAAAAGG + Intronic
1159361932 18:67416529-67416551 CAAGAGTTCTAGGAAACAAAAGG + Intergenic
1159420182 18:68208428-68208450 CAGCAGGTGTAGAGATCACATGG + Intergenic
1160294584 18:77625661-77625683 CAACAGCACCAGTGAACAAAGGG - Intergenic
1165369835 19:35398152-35398174 CAACAGCTCAACAGAAGAAAGGG + Intergenic
928081907 2:28319405-28319427 CATCAGGCCAAGAGAGCAAACGG - Intronic
928242500 2:29598554-29598576 CCATGGGTCTAGAGAGCAAAGGG + Intronic
928932180 2:36636184-36636206 CAACAGATCAAGAGAAGGAAGGG + Intronic
930674831 2:54189253-54189275 GAACAGGTCTAGAGACCTAATGG - Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932814227 2:74849078-74849100 CAACAAATGGAGAGAACAAAAGG - Intronic
933422358 2:82065893-82065915 CTAGAAGTCTAGAGAAGAAACGG - Intergenic
933822666 2:86128430-86128452 GCACAGCTCCAGAGAACAAAAGG - Intronic
935614142 2:105059246-105059268 CCACAGGAATAGAAAACAAAAGG - Intronic
937296758 2:120814131-120814153 CAACAGGTCTGGAGTGCAAAAGG - Intronic
937967526 2:127525482-127525504 CAACAGGACTAGCACACAAAGGG + Intronic
938630910 2:133166131-133166153 AAACAGCTATAGAGAACAGAAGG + Intronic
939059738 2:137406581-137406603 CAACTGCTCATGAGAACAAATGG - Intronic
944663228 2:201938471-201938493 CAACAGGTCTCAAAAACAATTGG - Intergenic
944781129 2:203018171-203018193 CAAAAAGTATAGAGAACAACTGG - Intronic
1172088899 20:32412851-32412873 CCCCAGGTCAAGAAAACAAATGG + Intronic
1173341232 20:42154707-42154729 CAGCAGGTTTAGGGAAGAAAAGG - Intronic
1174470281 20:50754553-50754575 CAACAAGTTTAGAGGACAATAGG + Intronic
1176092277 20:63323997-63324019 CAACAGGCCCTGTGAACAAAAGG - Intronic
1177945117 21:27458127-27458149 AAAGAGGTCTTCAGAACAAAAGG - Intergenic
1178050102 21:28737510-28737532 CAACACTTCTAAAGAAAAAAAGG - Intergenic
1178303100 21:31469024-31469046 CTTCAGTTCTAGGGAACAAAGGG + Intronic
1179459123 21:41521764-41521786 CAACATTTTTAGACAACAAATGG + Intronic
1181184700 22:21094686-21094708 TAACTTGTCTAGAGAAGAAATGG + Intergenic
1181330672 22:22088184-22088206 CACCAGGCCTAGAGAGCAGAGGG - Intergenic
1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG + Intergenic
1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG + Intergenic
949112526 3:279493-279515 TACCAAGTCTAGGGAACAAATGG + Intronic
949457059 3:4250156-4250178 CAACAGATCAAGACAAGAAACGG + Intronic
949678133 3:6481680-6481702 GCACATGTCTAAAGAACAAATGG - Intergenic
952336323 3:32406277-32406299 CAGCACGGCTAGATAACAAAAGG - Intronic
953029145 3:39166127-39166149 CAACAGGCCTGAAGAAAAAAAGG + Intergenic
953426810 3:42802138-42802160 CAACAGGTCAATGGAGCAAAAGG + Intronic
955002454 3:54939756-54939778 CTACTGGTCTATAGATCAAAGGG - Intronic
957003261 3:74911503-74911525 CACCATCTCTATAGAACAAAAGG + Intergenic
957018748 3:75100166-75100188 CAAAAGGCCCAGAAAACAAAAGG - Intergenic
957387348 3:79514014-79514036 CTAACGGTCTAGAGAACAAAAGG - Intronic
958160280 3:89809863-89809885 CAACAACTCTATAGCACAAAAGG + Intergenic
959344851 3:105180789-105180811 CAACAAGCCTGGAGAACAACTGG + Intergenic
959832781 3:110884205-110884227 CAACAGGTGGACAGAAGAAATGG + Intergenic
962041932 3:131716584-131716606 CAACATGTTTTCAGAACAAAGGG - Intronic
962671822 3:137715814-137715836 CAGCAGGTTTACAGAAGAAATGG + Intergenic
962690372 3:137890791-137890813 CAATAGGTCTAAAGAAGGAAGGG - Intergenic
963215697 3:142745118-142745140 CAACAGGAATAAGGAACAAAAGG + Intronic
963406606 3:144871668-144871690 CAACAGGGGTACACAACAAAAGG + Intergenic
963886492 3:150588496-150588518 CCCCAGGTGCAGAGAACAAATGG - Intronic
964783446 3:160366822-160366844 CAACAGGTTGAGAGTACAATTGG - Intronic
965929575 3:174026649-174026671 AAACAGGTGTTCAGAACAAAAGG + Intronic
966426583 3:179786462-179786484 CAACATGTCTAGGCATCAAAAGG - Exonic
970906232 4:21219609-21219631 CAACTGGTTGAGAGAAGAAAGGG + Intronic
971003422 4:22348114-22348136 CAAAAGATCTAGAGAACTGATGG - Intronic
971371664 4:26024234-26024256 CAACAGGGCTAGAAAGCAAAAGG + Intergenic
971582586 4:28361659-28361681 CAAGAGGTATAAAGAACAAAAGG + Intergenic
972400368 4:38696296-38696318 CAAGGCTTCTAGAGAACAAAGGG + Intronic
973760063 4:54107552-54107574 CAGCAGGTGCAGAGAAAAAAAGG + Intronic
974437509 4:61875158-61875180 GTGCAGGTCTACAGAACAAAGGG - Intronic
974515959 4:62911281-62911303 CAAAAGGTCTAGTGAACAAGAGG - Intergenic
976531679 4:86161455-86161477 CAAAAAGTCTAGAGTAGAAATGG - Intronic
978679255 4:111359035-111359057 CAAGAGGTGAAGAGAAAAAAAGG - Intergenic
978752046 4:112260751-112260773 TAAGAGGCCTAGAGAAAAAAAGG - Exonic
979188589 4:117831063-117831085 AAAGAGGTATAGACAACAAAAGG - Intergenic
981158720 4:141471391-141471413 CAAAAGGTCAAGAGAATACATGG + Intergenic
981904603 4:149907154-149907176 CAACAGGTAGAGTGAAAAAAAGG + Intergenic
982713881 4:158786267-158786289 GATCAGGTCCAGAAAACAAAAGG - Intronic
984172463 4:176376940-176376962 AAACTGTTCTAGAGAAAAAAAGG + Intergenic
985659820 5:1151526-1151548 CAACAGCTGCAGGGAACAAAAGG + Intergenic
987766296 5:22235711-22235733 CAGCAGGTCTAAAGAACATATGG + Intronic
988994294 5:36699909-36699931 CAAGAGAACTTGAGAACAAACGG + Intergenic
991229880 5:64320711-64320733 AAACAGATCCAGAAAACAAAAGG + Intronic
993071067 5:83164490-83164512 CAACAGATCTCCAGAACTAAGGG - Intronic
994098381 5:95868301-95868323 CAACAGGTGCAGAGATCACATGG - Intergenic
1000038673 5:157468445-157468467 CAAGAGGCCTAAAGAACAAGAGG + Intronic
1000382013 5:160637747-160637769 CAAGAAGTATAGAGAATAAAAGG + Intronic
1001943327 5:175756253-175756275 CAACAGGTACAAATAACAAAAGG + Intergenic
1005830311 6:29665640-29665662 CTACAGGACTGGAGAACATAGGG - Intronic
1006132968 6:31879773-31879795 CAACATTTATTGAGAACAAAAGG + Exonic
1006482426 6:34307726-34307748 GAACAGGAACAGAGAACAAAGGG + Intronic
1006779362 6:36621681-36621703 CAACACCTCTAGGGAACACATGG + Intergenic
1006821391 6:36898646-36898668 CATCATGCCCAGAGAACAAAAGG - Intronic
1009050524 6:58270171-58270193 AAACAGGTATAGAGAGCAACTGG - Intergenic
1009239890 6:61172215-61172237 AAACAGGTATAGAGAGCAACTGG + Intergenic
1012489897 6:99770752-99770774 AACCATGTCTAGAGAACTAAAGG - Intergenic
1012586482 6:100929120-100929142 TAACAGCTCAAGAGAACAATAGG + Intergenic
1012841069 6:104329677-104329699 CAACAGGTCTAGAGGTCTGAAGG + Intergenic
1015653428 6:135489817-135489839 GAACAGGTCTTAAGAAAAAATGG + Intronic
1018163803 6:161074929-161074951 CAACAGGTCTGGTCAACAAAAGG - Intronic
1025260271 7:57413755-57413777 CAACAGGGCCAGAGAGCAACAGG - Intergenic
1028836910 7:95384697-95384719 CAACAGGGCTAGAGAGGATATGG + Intronic
1030133027 7:106219254-106219276 CAACAGCACTAGAGAACAAAGGG + Intergenic
1030267025 7:107631331-107631353 CCACATGTCTGGAGCACAAACGG + Intergenic
1033532872 7:142283281-142283303 CAACAGTTCTTCAGAACATATGG + Intergenic
1033677015 7:143552793-143552815 TAACTGGACTATAGAACAAATGG - Intergenic
1033694820 7:143776644-143776666 TAACTGGACTATAGAACAAATGG + Intergenic
1037644847 8:20783901-20783923 AAACCACTCTAGAGAACAAAGGG + Intergenic
1038398188 8:27262401-27262423 CACCAAGTCCATAGAACAAAGGG + Intergenic
1040641688 8:49341763-49341785 CAGCTGGTCTAGAGAAAACATGG - Intergenic
1042519566 8:69697036-69697058 CAACAGTACTAGAGAACACAGGG + Intronic
1044303287 8:90609598-90609620 CAACAGATCGAGAGAAGTAAGGG - Intergenic
1044394185 8:91690284-91690306 CAACAGATGTAAAGAACATATGG + Intergenic
1044628214 8:94255260-94255282 GAACAAGTCTAGAGAAAAAGTGG + Intronic
1045912716 8:107428772-107428794 CAAGAGGTCAAAATAACAAATGG - Intronic
1047586172 8:126275599-126275621 AAACAGATTTAGAGAAAAAATGG + Intergenic
1051675032 9:19550329-19550351 CAACAGGAGCACAGAACAAAGGG + Intronic
1052946929 9:34176142-34176164 CAACAGCAATAGAGAAAAAAGGG - Intergenic
1053791863 9:41692227-41692249 CAAGATGTCTAGAGAATAAGAGG + Intergenic
1054153288 9:61622538-61622560 CAAAATGTCTAGAGAATAAGAGG - Intergenic
1054473087 9:65553742-65553764 CAAGATGTCTAGAGAATAAGAGG - Intergenic
1057890358 9:98865224-98865246 CCAGAGGCCTAGAGAGCAAAGGG + Intergenic
1058152140 9:101475369-101475391 CATCAGGTCAAGGAAACAAATGG + Exonic
1058775289 9:108277381-108277403 CAACAGGCCTAGAGAAAATCTGG - Intergenic
1060713653 9:125898101-125898123 CCACAGGTCCAAAGAACTAAAGG - Intronic
1188098485 X:26052126-26052148 CAAGACTTCTAGAGAAAAAAAGG + Intergenic
1189163682 X:38837706-38837728 CAAAAGGTATAGAGAAGAGAAGG + Intergenic
1189345490 X:40238011-40238033 CAACAGCTTTAGAGAACCCAGGG + Intergenic
1190441483 X:50479267-50479289 CTACAGATCTAGAGAGCAATTGG - Intergenic
1193956852 X:87874147-87874169 AAAAAGTTTTAGAGAACAAAAGG + Intergenic
1194966392 X:100293421-100293443 CAACATGTTTAGAGAACAAAAGG + Exonic
1195015237 X:100772570-100772592 CAAAAGATCAAGAAAACAAAAGG - Intergenic
1195965042 X:110422301-110422323 CAACAGGTAAGGACAACAAAAGG - Intronic
1196130834 X:112154244-112154266 AATCAGGTATAGAGAACTAAAGG - Intergenic
1196292959 X:113965516-113965538 GAAGTGGTCCAGAGAACAAAGGG - Intergenic
1198225690 X:134643240-134643262 CAACAAAACTAGAGAAGAAATGG + Intronic
1198384840 X:136118782-136118804 AAACAAGTCTAGAGAACAGTTGG - Intergenic
1198425536 X:136516127-136516149 GAAGAGGACAAGAGAACAAATGG - Intergenic
1198513541 X:137379380-137379402 CAACAGTTCTTGAAAACAATTGG + Intergenic