ID: 903050998

View in Genome Browser
Species Human (GRCh38)
Location 1:20600986-20601008
Sequence CAGTTAATACAGTTGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903050998 Original CRISPR CAGTTAATACAGTTGGAATA TGG (reversed) Intronic
900792335 1:4688841-4688863 GAGTTAATACAGTTCGAGTATGG - Intronic
903050998 1:20600986-20601008 CAGTTAATACAGTTGGAATATGG - Intronic
904733388 1:32611996-32612018 CATTTAAAACAGTTGGACTTGGG + Intronic
909219877 1:72943835-72943857 CAGTGAAAACTGCTGGAATATGG - Intergenic
909650558 1:77971595-77971617 TAGGAAATACAGTTGGTATATGG - Intronic
909753095 1:79189291-79189313 CTGTGAATGCAGTTGGCATAAGG - Intergenic
911442812 1:97949861-97949883 CAGCTAATACAGTTGTAAAAAGG - Intergenic
921699667 1:218254047-218254069 ATGTTAATACAATAGGAATATGG - Intergenic
923370664 1:233309239-233309261 CAGTTAAAATATTTGGAATATGG + Intergenic
923385349 1:233460524-233460546 CAGTCGCTAGAGTTGGAATATGG + Intergenic
1063513135 10:6666530-6666552 CAGTTAAGACAGTTCTCATATGG + Intergenic
1063829152 10:9932286-9932308 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1065421639 10:25551390-25551412 AAGGTAATACAGCTGAAATAAGG + Intronic
1068949415 10:62762160-62762182 CAGTTCCTGCAGTTGGAAAATGG - Intergenic
1073401925 10:103264820-103264842 CAGTTTATTCATTTGGAAAATGG + Intergenic
1074957238 10:118404116-118404138 CAGTTAATGCTGTTAGAAAATGG + Intergenic
1077837852 11:5939702-5939724 CATATCATACAGTAGGAATAGGG + Intergenic
1078234755 11:9473961-9473983 CAGGTCATTCAGTTGGAAGATGG + Exonic
1078625222 11:12949125-12949147 CACTTAATACAATTGCCATAAGG + Intergenic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1081508436 11:43742464-43742486 TATTTAAGACAGTGGGAATAAGG - Intronic
1083948179 11:65937757-65937779 CAGTAAATAGAGTAGGAATCAGG - Intergenic
1086049530 11:82573246-82573268 CAGATCATACAGCTAGAATATGG + Intergenic
1093071567 12:14710855-14710877 CATTGAATAGAGTTGGAATGGGG - Intergenic
1093658627 12:21726911-21726933 AAGTTAATTGAATTGGAATAAGG - Intronic
1093722068 12:22455340-22455362 CAATTAACACATTTGGGATATGG + Intronic
1093925511 12:24904497-24904519 CAGTTAATACAGATGGAGGCCGG - Intronic
1094802876 12:34057820-34057842 CAGTTAAGATAGTTGGAAGCTGG - Intergenic
1095116288 12:38356309-38356331 CAGTTAAGATAGTTGGAAGCTGG - Intergenic
1096379048 12:51139858-51139880 CAGTTCCTTCAGTTGGAAAATGG - Intronic
1097376621 12:58851128-58851150 CAGTTTATAGACTTGGAAGATGG - Intergenic
1098043453 12:66376552-66376574 AAGTTAATACAGATGGAATCAGG + Intronic
1098768811 12:74525364-74525386 CAGCAAATATAGGTGGAATAAGG - Intergenic
1101008203 12:100423316-100423338 CAGTTAAGATAGTATGAATAAGG - Intergenic
1101086375 12:101240494-101240516 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1102327530 12:112000802-112000824 CAGTTGTTACAGATTGAATACGG + Intronic
1103664157 12:122548618-122548640 CATTCAACAGAGTTGGAATATGG + Intronic
1104081861 12:125436148-125436170 CAGTTCAGACAGTTGGACTCCGG - Intronic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1107100206 13:36582201-36582223 CAGTAAATACAGTAGGAACTAGG - Intergenic
1108225831 13:48287752-48287774 CAGTTACTTCAGTTGTAAAAAGG + Intergenic
1109715062 13:66211485-66211507 CAGATAATCCAGTTGTACTATGG + Intergenic
1110671711 13:78188275-78188297 CAGTTCATATAGTTGGAGAATGG - Intergenic
1112227083 13:97550407-97550429 CAGTTAATACAGTTGAGGTGGGG + Intergenic
1114640521 14:24216647-24216669 CACTTAATAGAGTTGGAAAAAGG + Intronic
1117382004 14:55173899-55173921 CAGTTAATACAGTTATTACAGGG - Intronic
1118422303 14:65620245-65620267 CAGTCAACACAGTTGAAAAATGG - Intronic
1118630490 14:67698005-67698027 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1118953005 14:70451998-70452020 AATTTAATACAATTGGAATTGGG - Intergenic
1119370572 14:74137954-74137976 CAGGTAATTCATTTGGAAGAAGG - Intronic
1125142890 15:36430840-36430862 CATTTAAAACATTTAGAATATGG + Intergenic
1127853602 15:62936462-62936484 CAGTTAATACAAATGGAATATGG - Intergenic
1128295714 15:66517645-66517667 CAGTTAACAAAATTTGAATATGG - Intronic
1129366458 15:75058596-75058618 CAGCTAATCCAGGTGGAATCTGG + Intronic
1130958271 15:88642437-88642459 CTGTTAAGATAGATGGAATATGG + Intronic
1131879360 15:96846043-96846065 CAGTTACTTCACTTAGAATAAGG + Intergenic
1136238009 16:28926169-28926191 CAGATAATGCAGTTTGAAAATGG + Intronic
1137641128 16:50030894-50030916 CAGTTATTGCATTTGGTATAGGG - Intronic
1140024951 16:71278951-71278973 CAGTTAATACAGAAGGAACCTGG + Intergenic
1141317549 16:82976590-82976612 CAGTTTCTACAGTTGTAAAATGG - Intronic
1142910251 17:3083217-3083239 CAGTTTCTACAGTGGGAAAAGGG - Intergenic
1148488568 17:48007785-48007807 GAGTTAATTCAGTAGGAATGAGG - Intergenic
1149149056 17:53537107-53537129 CAGTAAATACAGTAGAAATTAGG - Intergenic
1149766758 17:59285328-59285350 CAGTAAGTACATTTGGCATATGG - Intergenic
1149854398 17:60067492-60067514 CAGTTCTTCCAGTTGGAAAAGGG - Exonic
1150829868 17:68509981-68510003 CAGTTAAGACACTAAGAATAAGG - Intergenic
1151406742 17:73892569-73892591 CTGTTAATACTGTTGCAATGGGG - Intergenic
1152385891 17:79974539-79974561 CATTTAATACTTTTGGATTATGG + Intronic
1154933985 18:21032177-21032199 GAGTTAAGACAGTTTGATTATGG - Intronic
1155915872 18:31556796-31556818 AAGTTAATATAGTTAGGATACGG + Intergenic
1160162538 18:76484729-76484751 AAGTTATTACAGTTAGAATTTGG - Intronic
1160688254 19:447434-447456 CAGTTTAAACAGTTGGGATTAGG + Intronic
1165236292 19:34424459-34424481 AAGTAAATATAGTTGGAAGAGGG + Intronic
1166650332 19:44569202-44569224 CAATTGACAAAGTTGGAATATGG + Intergenic
1167443552 19:49524379-49524401 CAGATAATACAGTGGTAAAAGGG - Intronic
1168154917 19:54467985-54468007 CAGTTCATACAGCTGGCAAAGGG - Intronic
926771015 2:16375285-16375307 CAGTCAATTCAGTTGAAACAAGG - Intergenic
927339960 2:21972236-21972258 AAGTTAATGTAATTGGAATAGGG + Intergenic
928264517 2:29800437-29800459 CACATAAAACAGTTGGAAGAAGG + Intronic
928620862 2:33086302-33086324 CAGTTAATAGAGTTGCAAGATGG + Intronic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
935066123 2:99650108-99650130 AAGTTTCCACAGTTGGAATATGG + Intronic
936464657 2:112736512-112736534 AAGTTAATACAATTGTATTAGGG - Intronic
937249824 2:120516311-120516333 CTGTTTATACAGTGGGAATAGGG - Intergenic
937506871 2:122547454-122547476 CATTTAAAACAGTTGGAGTTAGG - Intergenic
939131245 2:138237980-138238002 AAGGAAATACAGTTGGAAGAAGG - Intergenic
939616474 2:144367030-144367052 CAACTACTAAAGTTGGAATATGG - Intergenic
941208127 2:162600641-162600663 CAGTTCAGAAACTTGGAATATGG + Intronic
943036939 2:182758837-182758859 CAGTTACAATGGTTGGAATAGGG + Exonic
943455536 2:188102877-188102899 CAGGTCATACAGTTTGACTATGG - Intergenic
943670557 2:190655789-190655811 CACTTAGCACAGTTGGAATCTGG + Intronic
945304294 2:208244106-208244128 CAGTTAATTCACTTGAAATCTGG + Intronic
945855340 2:215062602-215062624 CAGCTAACACGGTTGCAATATGG - Intronic
947080837 2:226394677-226394699 GAGATAATACAGTTGCAAAATGG + Intergenic
947290142 2:228564056-228564078 CAGTTTATACAGTAGTAAAATGG + Intergenic
1168991470 20:2099899-2099921 CAATTATTACAGTTGCAAAATGG - Intergenic
1169506618 20:6218542-6218564 CAGTAAATAAAGTGGGAATCAGG + Intergenic
1169665822 20:8034200-8034222 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1170144513 20:13158121-13158143 CATGTAATACACTTGGAAGATGG + Intronic
1170171558 20:13419053-13419075 CAATTGATAAAGTTGGAAAAGGG + Intronic
1172284055 20:33728605-33728627 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1177071810 21:16519666-16519688 CAAATAATCCAGTTGCAATAAGG + Intergenic
1177192222 21:17864621-17864643 GAGTCAATACAGTGGGAAAATGG + Intergenic
1177353734 21:19979922-19979944 AGGTTAACACAGTTAGAATAGGG - Intergenic
1178523765 21:33307225-33307247 CAGTAAATAAAGTAGGAATCAGG - Intergenic
1180677601 22:17598537-17598559 CAGTTATTACATTTGAAACATGG + Intronic
1184001918 22:41681014-41681036 CAGTAAATTCAGGTGGAATACGG - Intronic
950340766 3:12242197-12242219 CAGTTGACAAAATTGGAATATGG - Intergenic
951230077 3:20168517-20168539 CAGAAAGTACAGTTGGACTATGG - Intronic
951915285 3:27794286-27794308 CAGATAATATAATTGGAATATGG - Intergenic
952087683 3:29846319-29846341 GAGTTAATATATTTTGAATAAGG + Intronic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
956166004 3:66398734-66398756 CAGTTAATTCAGTTGGTATTTGG - Intronic
956984530 3:74682916-74682938 CAGTTACTACAGTTGTTAGATGG + Intergenic
957556634 3:81770477-81770499 AAGTTAATACATTTGGGAAAGGG - Intergenic
959462991 3:106650185-106650207 CAGCTAAGACAGTTGTATTAGGG + Intergenic
962066286 3:131984638-131984660 TAGGTGATACAGTTGGAAGATGG - Intronic
963752764 3:149200429-149200451 TAGTTATTAAAGTTGGTATAGGG - Intronic
964517116 3:157523389-157523411 TATTTAATAGAGTTGGAAAAGGG - Intronic
965696496 3:171413812-171413834 CAGGTCATACAGCTAGAATATGG - Intronic
966269412 3:178086537-178086559 TAGGTAGCACAGTTGGAATACGG + Intergenic
966478429 3:180377166-180377188 CAGTCAATAAAGTAGGAATCAGG - Intergenic
968787730 4:2635973-2635995 CAGATAATGTAGTTGGAAAAAGG + Intronic
970746516 4:19304081-19304103 CAGTTAATGAAATTTGAATATGG + Intergenic
971463785 4:26932064-26932086 TAGCTAATACAGTTGTTATAAGG - Intronic
973724943 4:53765731-53765753 CAGGTAATTAAGTTTGAATAAGG + Intronic
974409881 4:61526179-61526201 AAGTTCATACAGATGTAATAGGG + Intronic
974601959 4:64095075-64095097 AATTTAATACATTTGCAATATGG - Intergenic
975398281 4:73903330-73903352 CAGTTACTACAGCTGGGAAAGGG + Intergenic
975401640 4:73944821-73944843 TAGTTAATAGAGTTGGGATGGGG + Intergenic
976647713 4:87402668-87402690 CAGATACTCCAGTTTGAATAGGG - Intergenic
977175784 4:93817907-93817929 CAGTAAATACAGTAGGAATTGGG - Intergenic
977685172 4:99839067-99839089 CAGTAGATCCAGTTGGACTAGGG + Intronic
979279209 4:118846191-118846213 AATTTAATGCAGTTGCAATATGG - Intergenic
979317928 4:119288410-119288432 CAGATAATACAGTTGGAAATAGG + Intronic
982220416 4:153119878-153119900 CAGTAAATAAAGTAGGAATCAGG + Intergenic
982806992 4:159778652-159778674 CAATTAAAACAGATGGAATGTGG - Intergenic
983004174 4:162462567-162462589 CAGTTAAGACAGTTGAAGCAGGG - Intergenic
984649960 4:182260399-182260421 TAGTTAACACAGTAGGAAAAAGG - Intronic
984963579 4:185121518-185121540 GTGTTGATACAGTTTGAATATGG + Intergenic
984994198 4:185412574-185412596 CAGGAAATGCAGTTGGAATGAGG + Intronic
985214336 4:187634623-187634645 CAGTAAATCCACTTGGCATATGG - Intergenic
987463696 5:18246983-18247005 CAGTAAATAAAGTAGGAATCAGG - Intergenic
987606485 5:20142606-20142628 AAGTTAATTCAGTTAAAATAAGG + Intronic
989235160 5:39139273-39139295 AATTTAATACATTTGTAATAAGG + Intronic
989238827 5:39180221-39180243 CCGTTAATACACTAGGAAGAAGG - Intronic
991185242 5:63799151-63799173 AAGATCATACAGTTGGGATATGG - Intergenic
994407707 5:99366089-99366111 CACCTAATCCAGTTGGAAGATGG + Intergenic
995055966 5:107758914-107758936 CAGCTAAGAAAGTTTGAATAGGG + Intergenic
997288572 5:132704418-132704440 CAAATAATAAAGCTGGAATATGG + Intronic
997560378 5:134841237-134841259 CAGTTACTACAGCTAGATTATGG + Intronic
999973206 5:156885423-156885445 CAGATATTATAGATGGAATAAGG - Intergenic
1001684574 5:173583865-173583887 CAGTTTAGACATTTGGAATTTGG - Intergenic
1002982972 6:2160451-2160473 GAGTTAATAAAGTTGGAGTTTGG - Intronic
1005007482 6:21302873-21302895 CAGTAAATACATTTGGAATTGGG - Intergenic
1005975949 6:30799401-30799423 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1006006066 6:31002597-31002619 CAGTAAATAAAGTAGGAATGAGG + Intergenic
1008233866 6:49019467-49019489 CACTTAATACAGTTTAATTATGG - Intergenic
1008494157 6:52115887-52115909 CAGTTAATAAAATTGTATTAGGG + Intergenic
1008892378 6:56509622-56509644 AAGGTAATACTTTTGGAATAGGG - Exonic
1009354232 6:62721309-62721331 CAGTCAATACTCTTGGAAAAAGG + Intergenic
1012210852 6:96517079-96517101 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1012362640 6:98402703-98402725 CAGATAATGGAGTTGGAAAATGG - Intergenic
1012452332 6:99365730-99365752 CAATTAATACAATTTAAATAAGG + Intergenic
1013930002 6:115519081-115519103 CAGTTAAGGCAGTAGGAAGAGGG + Intergenic
1017032045 6:150232826-150232848 TAGTTAAGACACTTTGAATAAGG - Intronic
1019076117 6:169389412-169389434 CAGTCAATTCATTTGGAAGAGGG - Intergenic
1021018667 7:15568016-15568038 CAGGTAATAAAGTTTGAATTTGG + Intergenic
1021782107 7:24116376-24116398 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1027834709 7:83226009-83226031 CAATTAATACATTTTAAATATGG + Intergenic
1028738234 7:94242199-94242221 CAGTTAAGACAGTTTGAATATGG + Intergenic
1029027787 7:97435750-97435772 GAGTTAATACAGTTCGGAGAAGG - Intergenic
1029854697 7:103503742-103503764 CTGTTAATACAGTGGGATTTAGG + Intronic
1031010273 7:116519330-116519352 TATTTAATACAGTGGAAATAAGG - Intergenic
1031832860 7:126648861-126648883 CAGTAAATATGGTGGGAATATGG - Intronic
1032247211 7:130223166-130223188 CAGGTCATACAGTTGGTAAATGG + Intergenic
1033910257 7:146254817-146254839 CAGTGATTACAGCTTGAATATGG - Intronic
1034189069 7:149199733-149199755 CAGCTAATGCAGCTGGAATTTGG - Intronic
1037005543 8:13775232-13775254 CAGTTATTTCATCTGGAATAGGG + Intergenic
1040433577 8:47367593-47367615 AATTTAAGACAGTGGGAATATGG + Intronic
1040594470 8:48824133-48824155 CAGTGTATACAGTTGTAACAGGG + Intergenic
1046465467 8:114596652-114596674 TAGTTAAGAGACTTGGAATATGG - Intergenic
1046995525 8:120516888-120516910 TAGTTAAGAAAGTTAGAATAAGG + Intronic
1047981185 8:130184380-130184402 CAGGTAAAAGAGTTGGAAAAAGG + Intronic
1048099163 8:131329046-131329068 CAGATAATGCAGTTGGAACAAGG - Intergenic
1051001050 9:12281978-12282000 CAGTAAATAAAGTAGGAATAAGG + Intergenic
1051200224 9:14609872-14609894 CAGATAATGTAGTTGGAAAAAGG - Intergenic
1051462732 9:17340917-17340939 CAATTAAAACAGTGGGAAGAAGG + Exonic
1052113962 9:24625951-24625973 CAGTGTATACAGTTGGAAAGGGG + Intergenic
1058075374 9:100645120-100645142 CAGTTATTCCACTTGGAATCTGG - Intergenic
1059320550 9:113465068-113465090 CAGGTAAAACACTTGGCATAAGG - Intronic
1187280081 X:17851841-17851863 TACTTAATACAGCTGCAATAGGG + Intronic
1188365385 X:29309188-29309210 CAGTTAAGACTATTGCAATAGGG + Intronic
1188637613 X:32453742-32453764 CAATTTATACAGTTGGCATGGGG + Intronic
1188975729 X:36673028-36673050 AGGTTAATACACTTGGAACAAGG - Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189375176 X:40460940-40460962 CAATTAGTACAGCTGGAATCTGG - Intergenic
1190051332 X:47151726-47151748 CAGTTGAGACAGTAGGAAGAAGG + Intronic
1191822511 X:65328180-65328202 CACTTTATACACTTGGAACATGG + Intergenic
1192984995 X:76388557-76388579 GAGTTACTTCAGTTAGAATAAGG + Intergenic
1195490811 X:105467454-105467476 CAGTGAATTATGTTGGAATATGG - Intronic
1195492021 X:105481620-105481642 CAGTTAATTTATTTGGAAGAAGG + Intronic
1195762966 X:108266845-108266867 CTGTGAGTACATTTGGAATAGGG + Intronic
1196051449 X:111309854-111309876 CAATTGATAAAGTTTGAATATGG + Intronic
1196305701 X:114100313-114100335 CAGCAAATATAGTTGGAGTAGGG + Intergenic
1197063636 X:122212937-122212959 CAGTTACTACACTTGAGATATGG - Intergenic
1197084743 X:122458487-122458509 CAGTTAATACATTGTGAAGAAGG + Intergenic
1198419774 X:136459506-136459528 CAATTAATCCAGTTGTAAAATGG - Intergenic
1200692658 Y:6322579-6322601 TAGTTAATAAAATTGAAATATGG - Intergenic
1201042615 Y:9852147-9852169 TAGTTAATAAAATTGAAATATGG + Intergenic