ID: 903051128

View in Genome Browser
Species Human (GRCh38)
Location 1:20602018-20602040
Sequence GGTTAGGATGAGAAGATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903051127_903051128 -9 Left 903051127 1:20602004-20602026 CCAACTACTTGGTAGGTTAGGAT 0: 1
1: 0
2: 2
3: 45
4: 756
Right 903051128 1:20602018-20602040 GGTTAGGATGAGAAGATCAGTGG 0: 1
1: 0
2: 0
3: 24
4: 245
903051121_903051128 19 Left 903051121 1:20601976-20601998 CCAGGTGTGGTGATGTATACCTG 0: 1
1: 62
2: 1196
3: 11341
4: 36338
Right 903051128 1:20602018-20602040 GGTTAGGATGAGAAGATCAGTGG 0: 1
1: 0
2: 0
3: 24
4: 245
903051124_903051128 0 Left 903051124 1:20601995-20602017 CCTGTGGTACCAACTACTTGGTA 0: 2
1: 16
2: 364
3: 7887
4: 65904
Right 903051128 1:20602018-20602040 GGTTAGGATGAGAAGATCAGTGG 0: 1
1: 0
2: 0
3: 24
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903051128 Original CRISPR GGTTAGGATGAGAAGATCAG TGG Intronic
901447077 1:9315126-9315148 GGCAAGGCTGAGAAGCTCAGCGG + Intronic
903051128 1:20602018-20602040 GGTTAGGATGAGAAGATCAGTGG + Intronic
904696333 1:32333789-32333811 GGGTAGGGTGAGAAGATTGGTGG - Intergenic
906020062 1:42620102-42620124 GGGTATGATGGGAAGATCATAGG + Intronic
906849185 1:49229556-49229578 GGGTAGGATGACATGGTCAGTGG + Intronic
907595502 1:55716034-55716056 GGTTAGGATTCTAAGATTAGGGG - Intergenic
907696778 1:56738868-56738890 GTTTGGGAAGAGAAGTTCAGGGG + Intronic
908049747 1:60216288-60216310 GTTTATGATGAGAACATTAGAGG - Intergenic
909829947 1:80175291-80175313 GGGTAAGCTGAGAAGATCAGAGG + Intergenic
910728913 1:90369490-90369512 TGTTACCATGAGAAGATCACTGG - Intergenic
911274017 1:95839785-95839807 GGTTAGGATGAGACTATTACTGG + Intergenic
911326262 1:96472893-96472915 GTTTACAATGAGAAGATCATTGG + Intergenic
912648718 1:111419484-111419506 GGTGAGGATGATTAGACCAGGGG - Intronic
913356750 1:117930175-117930197 GGTTAGGAAGCGGAGATCATGGG + Intronic
913582953 1:120245333-120245355 GGTCAGAATGAGAAGAACTGTGG - Intergenic
913625219 1:120653027-120653049 GGTCAGAATGAGAAGAACTGTGG + Intergenic
914564884 1:148856829-148856851 GGTCAGAATGAGAAGAACTGTGG - Intronic
914607942 1:149273413-149273435 GGTCAGAATGAGAAGAACTGTGG + Intergenic
914831387 1:151173459-151173481 GTTGAGGGTGAGAGGATCAGGGG - Intronic
914915953 1:151819391-151819413 GGTCAGGCTGAGAAGACCAGTGG + Intronic
915643893 1:157253129-157253151 GGTTAAGATGTGAAGATAAGAGG + Intergenic
915701823 1:157803795-157803817 GGATAGGCTGAGAAGGGCAGTGG - Intronic
915926453 1:160024172-160024194 GATTAGAATCAGAAGATCTGGGG + Intergenic
916091501 1:161310740-161310762 GGTGGAGATGGGAAGATCAGAGG + Intergenic
916909651 1:169332829-169332851 GGTGAGGATGTGGAGAACAGGGG + Intronic
919892851 1:201988607-201988629 GGTACAGATGACAAGATCAGAGG + Intronic
919929716 1:202213452-202213474 TCAAAGGATGAGAAGATCAGGGG + Intronic
920021996 1:202963315-202963337 AGTTAGGATGAGGAGAAGAGGGG + Intronic
922362336 1:224834677-224834699 GTTTAGGATGAGAATTTGAGAGG - Intergenic
922905800 1:229172905-229172927 GGTCAAGATGGGAAGATCACTGG + Intergenic
924676336 1:246182128-246182150 AGTTACGATGAGAACAACAGTGG - Intronic
1062977374 10:1694807-1694829 GGTTAGGATGAGCAGATGTCTGG + Intronic
1063424110 10:5938017-5938039 GGAACGGATGCGAAGATCAGTGG + Intronic
1064173484 10:13054335-13054357 GGATAGGATGAGTAGCTGAGGGG - Intronic
1065626819 10:27638308-27638330 GGTTTGGATTAGGAGATGAGAGG + Intergenic
1066314305 10:34228682-34228704 GGTTAGGATGAAAATGGCAGAGG + Intronic
1066415868 10:35221158-35221180 TGTTAGGTTGAGAAGGGCAGAGG - Intergenic
1067438675 10:46296109-46296131 GGTTAGGGTTAGGAGATCAAGGG - Intronic
1068223171 10:54069270-54069292 GAATAGGATGAGAAAAACAGTGG - Intronic
1068581526 10:58745850-58745872 GGTTAGGATGTGGAGATCTTTGG + Intronic
1069817928 10:71210332-71210354 GGTTAGGCTGAGAAGGGAAGTGG + Intergenic
1070622792 10:78026700-78026722 GTGTAGGATGAGAAGATAAGAGG - Intronic
1072257736 10:93636499-93636521 GTTAAAGATGAGAAGATCTGGGG + Intronic
1074690227 10:115997744-115997766 GTTTAGGATGAGAAGAGGTGGGG + Intergenic
1076444017 10:130499751-130499773 GGTTAAGATGAGTAGGTTAGGGG + Intergenic
1077364524 11:2156160-2156182 AGCTAGGGTGAGAAGACCAGGGG - Intronic
1080370667 11:31637221-31637243 GGTGAGGATGGCAAGATGAGAGG + Intronic
1081808105 11:45900899-45900921 GGTGGGGATGGGAAGCTCAGGGG + Intronic
1082176465 11:49065936-49065958 CGTTAGAATCAGAAGATCTGGGG + Intergenic
1086011807 11:82113589-82113611 GTTTAGGAAGAGAACATCAGAGG - Intergenic
1086428012 11:86705971-86705993 TGCATGGATGAGAAGATCAGGGG + Intergenic
1086689249 11:89769939-89769961 TGTTAGAATCAGAAGATCTGGGG - Intergenic
1086716609 11:90070032-90070054 TGTTAGAATCAGAAGATCTGGGG + Intergenic
1088220038 11:107560320-107560342 GGTTGGGAAGAGAAGAACAAGGG + Intronic
1088842689 11:113639999-113640021 GGTTAGGGTGAGACGAGGAGAGG + Intergenic
1089065896 11:115661831-115661853 GGTAAGGATGGCGAGATCAGTGG + Intergenic
1090533077 11:127611464-127611486 TGTAAGGATGTGAAAATCAGGGG + Intergenic
1092744322 12:11659455-11659477 GGTTTCCAGGAGAAGATCAGAGG - Intronic
1095519664 12:43047983-43048005 TGTTAGGATGGGGAGAACAGTGG + Intergenic
1095818417 12:46450307-46450329 GGTTCAGATAAGAAGATGAGTGG + Intergenic
1096418125 12:51431518-51431540 GGTTAGAATGGGAAGCTCATGGG + Intronic
1096973385 12:55684813-55684835 GGGTAGGGTGAGAAGGGCAGGGG - Exonic
1097738840 12:63214474-63214496 AATTAGGTTTAGAAGATCAGGGG - Intergenic
1098435789 12:70467151-70467173 GGTTAGGATGAGAACATCTTTGG + Intergenic
1098988891 12:77043314-77043336 GGTTGGGATGAGGAGACCAGTGG + Intronic
1098989562 12:77049623-77049645 GGTTATGATAAGAAGACCATGGG - Intronic
1104231415 12:126888323-126888345 GGGGTGGATGAGAAGATCAAAGG - Intergenic
1105045670 12:133001409-133001431 GGTTGGGGTGGGAAAATCAGTGG + Intronic
1105265384 13:18810164-18810186 GGTTAGGAAGACATGGTCAGTGG - Intergenic
1105537452 13:21281275-21281297 GGATGCAATGAGAAGATCAGAGG - Intergenic
1106229508 13:27810862-27810884 GGTTAAGGTGAGAGGATCATTGG + Intergenic
1106472367 13:30068454-30068476 AGTTAGGATTTCAAGATCAGTGG + Intergenic
1108204491 13:48073937-48073959 GTTTAGGAGGATAAGATTAGTGG + Intronic
1109490743 13:63096901-63096923 GACTAGGATGAGAAGAACACTGG - Intergenic
1110838274 13:80110171-80110193 GATTAGGATGTAAACATCAGGGG - Intergenic
1111545375 13:89727048-89727070 GGAGAGGGTGAGAAGATCAGTGG - Intergenic
1112846143 13:103646615-103646637 GGTTAGGATGAGGTTATTAGTGG + Intergenic
1113818277 13:113191091-113191113 GGCTGAGATGGGAAGATCAGTGG - Intronic
1114336816 14:21698882-21698904 GTTTATGATGAATAGATCAGGGG - Intergenic
1115108582 14:29791509-29791531 GGTGAGGAAAAGCAGATCAGTGG - Intronic
1115341216 14:32294840-32294862 GATTAGGATGAGGACATCTGTGG + Intergenic
1117546291 14:56797146-56797168 GGTTTAGAAGAGAAAATCAGAGG + Intergenic
1117554947 14:56874602-56874624 GCACAGGATGAGAAGTTCAGAGG - Intergenic
1118162129 14:63301338-63301360 GGGAAGGATGAGAAAATAAGGGG - Intergenic
1118814855 14:69303644-69303666 TGTTAGGATGGGAAGATTATGGG - Intronic
1119414244 14:74459018-74459040 GGTTGGGATGAGACGCTGAGTGG + Intergenic
1120446908 14:84610266-84610288 GGTAGGGATGAGAAGATAAAGGG + Intergenic
1121402159 14:93689385-93689407 GGGTAGGAGGAAAAGATCACTGG + Intronic
1202833114 14_GL000009v2_random:57938-57960 GGTTAGGAAGACATGGTCAGTGG + Intergenic
1125799184 15:42429541-42429563 GGGTAGGATGAGAAAAGCTGTGG + Intronic
1125824090 15:42660754-42660776 GGTTAGGAAGAGACCATCAGAGG + Intronic
1126052476 15:44698876-44698898 GGTGAGGATGTGAAGAAAAGGGG - Intronic
1129113176 15:73350163-73350185 GGTTCTGATGAGAGGATCAGAGG - Intronic
1131131416 15:89903126-89903148 GGGTAGGATGAGAAGACGACAGG - Intronic
1132969226 16:2677322-2677344 GATTAGGATGAGAACATCTGTGG - Intergenic
1133711157 16:8402281-8402303 GGGAAGTATGAGAAAATCAGAGG + Intergenic
1136480098 16:30535781-30535803 GGTAAGGCTGAGAAAGTCAGAGG + Intronic
1136483959 16:30559233-30559255 GGTAAGGTTGAGAAAGTCAGAGG + Intergenic
1139249528 16:65481668-65481690 GGATAAGATCAGAAGAGCAGTGG - Intergenic
1139367175 16:66440647-66440669 GGTGAGGCTGAGAAGGTCTGGGG - Intronic
1140934973 16:79662016-79662038 GTTTAGGATGAGACGATCTTTGG + Intergenic
1141071745 16:80962707-80962729 GGAGAGGCTGAGAAGATCAATGG + Intergenic
1142526429 17:544978-545000 GGCTAGGGTGAGAGGATCACTGG + Intronic
1142927602 17:3254551-3254573 GGTGAGCATGAGAAGAAAAGGGG + Intergenic
1147337571 17:39736887-39736909 GGTTAGGAGGTGGAGATCAAAGG - Intergenic
1147887791 17:43696355-43696377 GGTTAGGACAGGAAGGTCAGGGG + Intergenic
1148771237 17:50068087-50068109 GGTCAGGGTCAGAAGACCAGCGG + Exonic
1149307000 17:55357738-55357760 AGGTAAGATGAGAAGATAAGGGG + Intergenic
1150378312 17:64700615-64700637 TGTGAGCATGAGAGGATCAGAGG - Intergenic
1150398042 17:64836555-64836577 GTTTAGGATGAGCAGATCTTGGG + Intergenic
1150424550 17:65067070-65067092 GCTTAGGATGGGTACATCAGTGG + Intergenic
1151115007 17:71725747-71725769 AGTTAGGAAGAGAACATCAGAGG - Intergenic
1151272915 17:73010922-73010944 GGAGAGGTTGTGAAGATCAGAGG - Intronic
1151474982 17:74340215-74340237 ATTTAGGATGAGAGGAGCAGGGG - Intronic
1152214123 17:79022712-79022734 CGCTAGGCTTAGAAGATCAGGGG - Intergenic
1152317085 17:79587452-79587474 AGTTAGGATGAAAACAGCAGGGG - Intergenic
1154423012 18:14251361-14251383 GGTTAGGAAGACATGGTCAGTGG + Intergenic
1156328506 18:36096932-36096954 TGATAGGAAGAAAAGATCAGTGG - Intergenic
1157041332 18:44043173-44043195 GCTTAGGATGACAAGAACATTGG + Intergenic
1158267207 18:55672977-55672999 GGTGTGAATGAGAAGATAAGAGG + Intergenic
1159088418 18:63820097-63820119 GGTTTGGATGAGAATATTAATGG - Intergenic
1159402949 18:67960751-67960773 GCTTATGGTGAGCAGATCAGAGG + Intergenic
1160029161 18:75243527-75243549 GGGGAAGATGAGGAGATCAGGGG + Intronic
1166031709 19:40136090-40136112 GGTTAGGATGTGAACATCTTTGG - Intergenic
1166042513 19:40212539-40212561 GGTTAGGCTGTGAAGAGGAGGGG + Intronic
1166194073 19:41194643-41194665 GGTCAGGCTGAGGAGTTCAGCGG + Exonic
1166566338 19:43767710-43767732 GGGTGGGAGGAGAGGATCAGAGG + Intronic
1168260534 19:55191561-55191583 CGTTAGGATGAGAGGCTCAGGGG + Intronic
1168628159 19:57935119-57935141 GGTTAGGATGAGGTGACCTGAGG + Intronic
1202639560 1_KI270706v1_random:69772-69794 GGTTAGGAAGACATGGTCAGTGG - Intergenic
926473536 2:13292635-13292657 GGTGAGGATGTGAAGAAAAGAGG - Intergenic
928872916 2:36002149-36002171 GGTTAGCAGCAGAAGATAAGTGG + Intergenic
928991251 2:37234775-37234797 GGTTTGGATGAGAGGAGAAGGGG + Intronic
930046023 2:47174008-47174030 TGTTAGGCTCAGAAGATCAAAGG - Intronic
931448557 2:62348008-62348030 GGAGAGCATGAGAAGGTCAGAGG - Intergenic
931936598 2:67204635-67204657 GGTGAGGTTGAGAAGACCAAAGG - Intergenic
932872158 2:75412802-75412824 GCTTAGGATGTGAACATCATTGG + Intergenic
933521385 2:83379247-83379269 GTTTCTGATGAGAAGATGAGAGG - Intergenic
934813411 2:97304036-97304058 GGTCTGGAGGAGAAGAGCAGAGG + Intergenic
934824284 2:97404444-97404466 GGTCTGGAGGAGAAGAGCAGAGG - Intergenic
934884181 2:98010132-98010154 GGGTAGGATGAGAAGTCCTGTGG - Intergenic
935786088 2:106550079-106550101 GGTTAGGATGTGAACATCTTTGG + Intergenic
936731281 2:115384271-115384293 GGTCAAGATGGGAAGATCACTGG + Intronic
936826071 2:116582555-116582577 GGTTAGGATGAGGAGAAAATTGG + Intergenic
936884437 2:117293299-117293321 GGTTTGCATTAGAAGAACAGAGG - Intergenic
937424158 2:121784190-121784212 TTTTAGGATGAGCAGAGCAGTGG - Intergenic
938417184 2:131113314-131113336 TTTTAGGAGGAGAAGGTCAGGGG - Intronic
939321202 2:140625070-140625092 GGTTAAGGTGAGAAGCTCATTGG + Intronic
942422380 2:175821297-175821319 GCTTGGGATGAGAAGATGAGGGG - Intergenic
943897431 2:193382881-193382903 TTTAAGGAAGAGAAGATCAGAGG + Intergenic
1169804598 20:9546482-9546504 GGGTAGGATGAGAAGGTCCTTGG + Intronic
1171886226 20:30654127-30654149 GGTTAGGAAGACATGGTCAGTGG - Intergenic
1172806755 20:37617557-37617579 GGTAAGGATGAGTGGATTAGTGG + Intergenic
1173165031 20:40682194-40682216 TGTAAGGAAGAGAAGATTAGAGG - Intergenic
1175366585 20:58460409-58460431 GGTCAGGATGGGAAGAACTGGGG + Exonic
1175642575 20:60643243-60643265 AGTAAGTATGAGAAGTTCAGGGG + Intergenic
1176157633 20:63629892-63629914 GGTTAGGATGTGAATATCTTGGG + Intergenic
1176647889 21:9367371-9367393 GGTTAGGAAGACATGGTCAGTGG - Intergenic
1176720649 21:10390031-10390053 GATTAGGATGTGAAGATCTTTGG - Intergenic
1176850447 21:13908587-13908609 GGTTAGGAAGACATGGTCAGTGG - Intergenic
1177207863 21:18031183-18031205 GGTTGCCATGAGAAGTTCAGTGG - Intronic
1177221269 21:18195925-18195947 GGTTATGAGGAGAAGGTCAGAGG + Intronic
1180301850 22:11042874-11042896 GATTAGGATGTGAAGATCTTTGG - Intergenic
1180362381 22:11912098-11912120 GGTTAGGAAGACATGGTCAGTGG + Intergenic
1183492581 22:38124509-38124531 TGGGAAGATGAGAAGATCAGAGG - Intronic
950548876 3:13654762-13654784 GGTTAGGAGTGGAAGGTCAGGGG + Intergenic
950663459 3:14481237-14481259 AGTTAGGATGAGAAGATGTGGGG + Intronic
952753679 3:36847124-36847146 GGCTTGGAAGAGAAGATGAGAGG - Intronic
955642887 3:61105635-61105657 GGTTGGGATGGGAAGAGCTGGGG - Intronic
956785623 3:72639867-72639889 GATCAGGACGAGAAGAACAGAGG - Intergenic
957384055 3:79472279-79472301 GTTTAGGATTAGAAATTCAGAGG + Intronic
957885810 3:86286283-86286305 GGTTAGGAAGAGGGGATAAGAGG - Intergenic
962876265 3:139538211-139538233 GGCAAGGATGGGCAGATCAGGGG + Intronic
963055101 3:141179740-141179762 GGTGAGGAAGAGAAGAGCAGAGG + Intergenic
964014154 3:151926149-151926171 GGTTAGGATAAAAAGAAAAGAGG - Intergenic
964553522 3:157910993-157911015 GTATAGGGTGAGAAAATCAGTGG + Intergenic
965751190 3:171976508-171976530 GCTTAGGAGGAGAGGAGCAGTGG + Intergenic
966925015 3:184639089-184639111 GGTTTAGATGAGAATATCAGGGG + Intronic
1202738996 3_GL000221v1_random:37616-37638 GGTTAGGAAGACATGGTCAGTGG + Intergenic
970093472 4:12435418-12435440 GGTTAGAATCAGTAGATCATAGG - Intergenic
971046863 4:22814630-22814652 GGTTTGGACTACAAGATCAGTGG - Intergenic
973369809 4:49236125-49236147 GGTTAGGAAGACATGGTCAGCGG - Intergenic
973391223 4:49559287-49559309 GGTTAGGAAGACATGGTCAGCGG + Intergenic
975912936 4:79290236-79290258 GGTTAGGATGGGGAGATGGGAGG + Intronic
977295880 4:95208578-95208600 GGTTAGAATGAGAACATAAATGG - Intronic
977441644 4:97075522-97075544 GGATAGGATGTGATCATCAGAGG + Intergenic
980210959 4:129786903-129786925 TGTTTGGATGGGAAGATTAGAGG + Intergenic
980733827 4:136856295-136856317 GGTCAGGATGAGAAGCTCTAAGG + Intergenic
983064870 4:163196863-163196885 GATTAGAATGAGATGATCTGAGG - Intergenic
983239100 4:165210855-165210877 GATCAGTAAGAGAAGATCAGAGG - Intronic
985145913 4:186894405-186894427 GTTAAGGATAAGAAGGTCAGGGG - Intergenic
1202766919 4_GL000008v2_random:155627-155649 GGTTAGGAAGACATGGTCAGTGG - Intergenic
987087350 5:14483319-14483341 GGTGAGGTAGAGAAGAGCAGAGG + Intronic
987586815 5:19865984-19866006 GGATAGGAGGAGAATATAAGTGG - Intronic
990617149 5:57519718-57519740 GGTAAGGATTAGGAGTTCAGAGG - Intergenic
991338932 5:65583711-65583733 GGTTAAGACAGGAAGATCAGTGG + Intronic
991579303 5:68137559-68137581 GGTTAGGAACAGAAAGTCAGTGG - Intergenic
992227553 5:74633908-74633930 GGATAGAATGAGATGATCCGTGG + Intronic
993396655 5:87397759-87397781 GGGTAGGATTAGTAGTTCAGTGG + Intronic
993983578 5:94570525-94570547 GGTTAGGGTAAGAAGGTCTGTGG - Intronic
994427387 5:99607826-99607848 GGATAGGATAAGAAGATGAAGGG + Intergenic
995440438 5:112185980-112186002 GGTTAGGAAGAGACAATCACGGG + Intronic
996376266 5:122811221-122811243 GGTTAGGAAGAGAAAAGGAGTGG + Intronic
999591596 5:153154140-153154162 GGTGAGGATGTGAAGAAAAGGGG + Intergenic
999835362 5:155364521-155364543 GGTGAGGATGAGAAGAGAAGAGG + Intergenic
1000016813 5:157285311-157285333 GGGAAGGAAGAGAAGGTCAGTGG - Intronic
1000152493 5:158517385-158517407 GGTGAGGATGAGAAGCACAGCGG + Intergenic
1001043477 5:168353535-168353557 GGTTGAGATGAGAAGGACAGAGG - Intronic
1001059874 5:168479113-168479135 GGTTTGGATGAGTAGATGGGTGG - Intergenic
1002811001 6:628646-628668 GGTTATGAAGAGCAGCTCAGAGG + Intronic
1004673819 6:17822456-17822478 GGTTTGGCTGAGAGGATCAGAGG + Intronic
1005713702 6:28526448-28526470 GGTTTGGAGGAGAAGCTGAGTGG + Intronic
1006452132 6:34111495-34111517 GGGCAGGATGGCAAGATCAGGGG - Intronic
1006924084 6:37644613-37644635 TTTGAGGATGAGAAGATCTGTGG - Exonic
1007010364 6:38411116-38411138 GGAGAGGAAGACAAGATCAGAGG + Intronic
1007274836 6:40665640-40665662 GGGTAGGATGAGAAGCTATGAGG + Intergenic
1007974961 6:46091989-46092011 GGTGAGGATGAGGAGAAAAGGGG - Intergenic
1010786062 6:80003228-80003250 GGTTTGGGTAGGAAGATCAGGGG + Intergenic
1011656292 6:89555061-89555083 GGAGAGGATGAGAAGAGAAGGGG - Intronic
1011834454 6:91413851-91413873 GGTTAGGATGTGAATATCTTTGG - Intergenic
1013506205 6:110802831-110802853 GGTTAGGATGAGAAAACAAAAGG + Intronic
1014652663 6:124059681-124059703 GCTCAGGATGTGAAGAGCAGTGG - Intronic
1016782332 6:147973230-147973252 GGTGAGGATGTAAAGATCAGAGG - Intergenic
1024784390 7:52890152-52890174 AGTTATGATGAGAACAACAGAGG + Intergenic
1024964607 7:55012792-55012814 GGCTGAGATGAGAAGATCACCGG + Intergenic
1027216988 7:76190098-76190120 GGTTAGGATGAGGAGAGAATGGG - Intergenic
1028105622 7:86874741-86874763 GGTAAGGATGTGAAGAAAAGGGG + Intergenic
1030814729 7:114022012-114022034 ATTTAGAATGAGAAGAGCAGTGG - Intronic
1031624525 7:123976739-123976761 GGTTAGAATGAGGAGAACACAGG - Intergenic
1032902644 7:136327660-136327682 GGCTAGAAAGAGATGATCAGAGG + Intergenic
1034952052 7:155305223-155305245 GGTTAGGCTTAGAACCTCAGAGG - Intronic
1037581690 8:20249347-20249369 GGTTGGGATGAGAAGCAGAGGGG + Exonic
1039533090 8:38282308-38282330 GGTTAGGATGAGATGAGTGGAGG - Intronic
1047536699 8:125726613-125726635 TGCTAGGATGAGAAGGGCAGAGG + Intergenic
1047849786 8:128844249-128844271 GGTTAGCATGAGAGGTTCTGGGG - Intergenic
1048815954 8:138333886-138333908 GGTCAGGATCAGGAGGTCAGTGG - Intronic
1049112070 8:140652726-140652748 GGTTGGGATGAGAAGAGCCGGGG - Intergenic
1050730464 9:8703609-8703631 GGTGAGGATGAGAAGTCGAGGGG - Intronic
1050882634 9:10722003-10722025 GCCTAGGATGAGAATTTCAGGGG - Intergenic
1053305684 9:36982906-36982928 GGTAAGCATGATCAGATCAGAGG + Intronic
1053662078 9:40291135-40291157 GGTTAGGAAGACATGGTCAGTGG + Intronic
1053912527 9:42921303-42921325 GGTTAGGAAGACATGGTCAGTGG + Intergenic
1054374205 9:64437375-64437397 GGTTAGGAAGACATGGTCAGTGG + Intergenic
1054522532 9:66085149-66085171 GGTTAGGAAGACATGGTCAGTGG - Intergenic
1054862434 9:69967608-69967630 GATTAGGATGAGGACATCTGTGG + Intergenic
1055231200 9:74067795-74067817 GATAAGGATTATAAGATCAGAGG - Intergenic
1056317045 9:85400240-85400262 GACTAGGATAAGAAGTTCAGTGG - Intergenic
1056805039 9:89721856-89721878 TGTTAGGATGCAAAGACCAGTGG + Intergenic
1057090403 9:92252911-92252933 GTTTAGGATGAGCAGAGCATAGG - Intronic
1058056521 9:100454541-100454563 GGTTAGGATGAGATGATAGCAGG + Intronic
1058500492 9:105610551-105610573 AGGTAGGGTGAGAAGAACAGGGG - Intronic
1059203523 9:112441409-112441431 GTGTAGGATGAGAAGGGCAGAGG + Intronic
1060226890 9:121797272-121797294 GGTTGGGATTGGAAGATGAGAGG - Intergenic
1202630938 M:15732-15754 GGTTAGAATGAGGAGGTCTGCGG - Intergenic
1203707724 Un_KI270742v1:68060-68082 GGTTAGGAAGACATGGTCAGTGG + Intergenic
1203547669 Un_KI270743v1:140504-140526 GGTTAGGAAGACATGGTCAGTGG - Intergenic
1185844164 X:3421613-3421635 GGGAAGGATGAGAGGGTCAGGGG + Intergenic
1186201494 X:7159449-7159471 TTTTAGGATGAGAAGAGCAAGGG - Intergenic
1187862126 X:23692629-23692651 GGAGAGTATGAGAAGGTCAGCGG + Intergenic
1188230957 X:27662114-27662136 TCTTGGGATGATAAGATCAGGGG + Intronic
1190313602 X:49134975-49134997 GGGTAGGATGAGGAGCTTAGTGG + Intergenic
1190782053 X:53606825-53606847 GGGGAGGATGAGAAGTTCAATGG + Intronic
1192048143 X:67698239-67698261 CTTTAGGATTAGAAGGTCAGAGG - Intronic
1192198114 X:69045914-69045936 GCTGAGGATTAGGAGATCAGTGG + Intergenic
1192386459 X:70676872-70676894 GTTTAGGATGAGAAGCACATTGG - Intronic
1194330211 X:92573781-92573803 GCTTAAGATGAGAATAACAGAGG + Intronic
1194583409 X:95704608-95704630 GGGTAGGAGGAGATGATCAGTGG - Intergenic
1195724967 X:107905316-107905338 GGGTAGGGTGAGAAGGTGAGTGG + Intronic
1197256594 X:124269934-124269956 GGTGAGGATGAGAATCCCAGAGG - Intronic
1200638921 Y:5692961-5692983 GCTTAAGATGAGAATAACAGAGG + Intronic