ID: 903055767

View in Genome Browser
Species Human (GRCh38)
Location 1:20634918-20634940
Sequence ATGAGCAATAAGAACTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903055767_903055775 22 Left 903055767 1:20634918-20634940 CCATCCCAGTTCTTATTGCTCAT 0: 1
1: 0
2: 0
3: 30
4: 243
Right 903055775 1:20634963-20634985 TCTGGCCAGTTTGGGGTGACAGG 0: 1
1: 0
2: 1
3: 15
4: 164
903055767_903055774 15 Left 903055767 1:20634918-20634940 CCATCCCAGTTCTTATTGCTCAT 0: 1
1: 0
2: 0
3: 30
4: 243
Right 903055774 1:20634956-20634978 TTTGAGCTCTGGCCAGTTTGGGG 0: 1
1: 0
2: 0
3: 18
4: 250
903055767_903055773 14 Left 903055767 1:20634918-20634940 CCATCCCAGTTCTTATTGCTCAT 0: 1
1: 0
2: 0
3: 30
4: 243
Right 903055773 1:20634955-20634977 GTTTGAGCTCTGGCCAGTTTGGG 0: 1
1: 0
2: 0
3: 10
4: 155
903055767_903055771 4 Left 903055767 1:20634918-20634940 CCATCCCAGTTCTTATTGCTCAT 0: 1
1: 0
2: 0
3: 30
4: 243
Right 903055771 1:20634945-20634967 ACTGTCTCATGTTTGAGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 146
903055767_903055772 13 Left 903055767 1:20634918-20634940 CCATCCCAGTTCTTATTGCTCAT 0: 1
1: 0
2: 0
3: 30
4: 243
Right 903055772 1:20634954-20634976 TGTTTGAGCTCTGGCCAGTTTGG 0: 1
1: 0
2: 1
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903055767 Original CRISPR ATGAGCAATAAGAACTGGGA TGG (reversed) Intronic
900802574 1:4746477-4746499 ATGAGCAATAACGGGTGGGACGG + Intronic
901476673 1:9494934-9494956 ATGAGCGAGAAGACCAGGGAAGG - Intergenic
902439294 1:16418836-16418858 ATGAGAAATAAGAACTAGGCCGG - Intronic
903055767 1:20634918-20634940 ATGAGCAATAAGAACTGGGATGG - Intronic
903296208 1:22344697-22344719 AGAAGCAAAAAGAAGTGGGAGGG + Intergenic
903787561 1:25871561-25871583 TTGAGGAATATGAATTGGGAGGG - Intergenic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
907655578 1:56338943-56338965 ATGAGTAATAAGCACAGGAAAGG - Intergenic
909333082 1:74438509-74438531 ATGAGGATTTAGAACTGGGAGGG + Intronic
909684244 1:78328714-78328736 ATCAGGAAAAAGAACTGGAAAGG - Intronic
910611637 1:89150238-89150260 ATGAGCACGAACAACTGGTAAGG - Intronic
912446612 1:109741141-109741163 GTGAGCATTAGGAAGTGGGAGGG - Intronic
914250389 1:145917598-145917620 ATGAGAAAGAAGAACAGAGAGGG + Intronic
918283327 1:183026613-183026635 ATGTGAAATTTGAACTGGGAGGG - Intronic
924573215 1:245256936-245256958 ATCAGGAAAAAGACCTGGGAAGG - Intronic
1063651961 10:7946768-7946790 ATGGAAAATAACAACTGGGAAGG - Intronic
1063934392 10:11062166-11062188 ATGAGCACTAATATCTGGAAAGG - Intronic
1064565394 10:16633945-16633967 ATGAGAATTAGGAATTGGGAGGG - Intronic
1065515160 10:26517334-26517356 ATGGGTAGTAAGGACTGGGAAGG - Intronic
1067935915 10:50611969-50611991 AGGAGAAATCAGGACTGGGAGGG - Intronic
1070499757 10:77061385-77061407 ATGACAAATAACCACTGGGAAGG + Intronic
1071417959 10:85458628-85458650 ATGAGAAATTAGAGCTGGGAAGG + Intergenic
1071768078 10:88691348-88691370 ATGAGCAATAAGAAATCTGAAGG + Intergenic
1072415899 10:95246641-95246663 ATGAGAAAACAGACCTGGGAAGG + Intronic
1078511459 11:11987417-11987439 ATGAGAAATCAGAGATGGGAGGG - Intronic
1078895886 11:15596836-15596858 TGGAGCCAAAAGAACTGGGATGG - Intergenic
1079615927 11:22493064-22493086 ATGAGAAATGAGATATGGGAAGG - Intergenic
1081711819 11:45221737-45221759 CTGAGCAGTAAGAAATAGGAAGG + Intronic
1083940821 11:65894524-65894546 ATGAGCTGTAAGCACTAGGAGGG + Intronic
1084334576 11:68449185-68449207 ATGAGAAATGTGAACTGTGATGG + Exonic
1085924185 11:80995977-80995999 ATGGGCAATTAGACCTGCGATGG - Intergenic
1087641895 11:100763963-100763985 AAGAGGAAGAAGAACTGGGAAGG - Intronic
1088059602 11:105630906-105630928 ATGAGACATAAGAACTCAGAGGG - Intronic
1088177837 11:107074074-107074096 ATGAACAATAAGAACTGTGTGGG + Intergenic
1089036461 11:115398513-115398535 ATGAGCAATATTCACTGAGAGGG - Intronic
1089919800 11:122197871-122197893 ATTAGAAATAAGCAATGGGATGG - Intergenic
1093504566 12:19850202-19850224 ATGAGCAGGAAGAATTGGGCTGG + Intergenic
1093950344 12:25158523-25158545 ATGAGAAAGAAGAAATGGAAAGG - Exonic
1094309542 12:29064175-29064197 AAGAATAATATGAACTGGGAAGG - Intergenic
1096103637 12:48984122-48984144 GTGAGGAATCAGAACTGAGATGG - Intergenic
1096423959 12:51485080-51485102 GAGAGCAATAAGAGCTGGGGTGG + Intronic
1097090118 12:56498132-56498154 ATGAGCAATAAAGTCTGGGTAGG + Intergenic
1097541442 12:60948767-60948789 ATGAGCACAAATAACTGGGGGGG - Intergenic
1098049460 12:66438252-66438274 ATGAGAAATTAGAACTGGCTGGG + Intronic
1099251615 12:80262486-80262508 ATGAGCAATGAGTAATGAGATGG - Intronic
1100940953 12:99722553-99722575 ATGAGCAATAATAATTTGAAAGG - Intronic
1101040867 12:100754235-100754257 ATGAGCAATTAGATGTGGGAAGG - Intronic
1101475931 12:105048429-105048451 ATGAGCAAAAGGTACTGGGAAGG + Intronic
1106574236 13:30959268-30959290 ATGAGGAATAAGAGTAGGGATGG - Intronic
1109244042 13:59930854-59930876 AAGGGCAATAACAACAGGGAAGG + Intronic
1109728118 13:66372025-66372047 ATAAGTATTAAGAAGTGGGAGGG - Intronic
1109950497 13:69497058-69497080 ATGAGCAAAAGAAAGTGGGATGG - Intergenic
1114510381 14:23254470-23254492 AATAAAAATAAGAACTGGGAAGG + Intronic
1116294122 14:43083888-43083910 ATGTGAAATAATATCTGGGATGG - Intergenic
1116715830 14:48425278-48425300 ATGGGCAGTAAGAACTGTCATGG + Intergenic
1117892054 14:60433349-60433371 ATGAGCTAGAAAACCTGGGAAGG - Intronic
1118997472 14:70849719-70849741 ATCAGCAAAAAGAACTGAGAAGG + Intergenic
1119291692 14:73500425-73500447 ATGAGAGATTGGAACTGGGAAGG - Intronic
1120153609 14:81065478-81065500 GTGAGCAATAAGAAGAGGGTTGG + Intronic
1120433236 14:84445933-84445955 ATGAGTAATTAAAACTGGGGAGG - Intergenic
1121036503 14:90708596-90708618 ATGAGCAGTAATATCTGGAAAGG - Intronic
1121235004 14:92385833-92385855 AAGAGCATTAAGGTCTGGGATGG - Intronic
1121940100 14:98062491-98062513 ATGGGCAAGGAGAACTTGGAAGG - Intergenic
1122021484 14:98841470-98841492 AAGAGCAAAAAGAATTGGGAGGG + Intergenic
1122172327 14:99887283-99887305 ATAAGCAATAAGAACTGTGCTGG + Intronic
1122272795 14:100575857-100575879 ATGTGCAAGAAGCCCTGGGATGG + Intronic
1122698456 14:103570371-103570393 ATGGGCAAGAAGAACTGTCAGGG - Intronic
1122853946 14:104551307-104551329 CTGACCAATAAGGACTGGAAGGG + Intronic
1123166117 14:106326707-106326729 GAAACCAATAAGAACTGGGAGGG + Intergenic
1202832681 14_GL000009v2_random:53868-53890 CTGGGAAATAAGAACGGGGAGGG + Intergenic
1125171525 15:36771081-36771103 AGGATAAATAAGAACTGGAAAGG + Intronic
1128349071 15:66877091-66877113 ATGAGAAATCAGGGCTGGGAAGG - Intergenic
1129976980 15:79830851-79830873 ATGAGCAATAAGAAGAGAGGAGG + Intergenic
1131789009 15:95944203-95944225 AATAGCCATAAAAACTGGGAGGG - Intergenic
1134843148 16:17417478-17417500 ATGAGCAAGCAGGAATGGGAAGG - Intronic
1134868656 16:17631765-17631787 GAGAACAATAAGAGCTGGGAGGG + Intergenic
1141595483 16:85094716-85094738 ATGGGCAATGAGCCCTGGGAAGG + Intergenic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1144109581 17:12019458-12019480 AGGAGCAACAAGAGCTGGGTGGG + Intergenic
1146287745 17:31585581-31585603 TTGAGCAATAGGAAATGGGAGGG + Intergenic
1148979581 17:51560758-51560780 ATGAGCAAGAAGCAGTGGAATGG - Intergenic
1151178128 17:72305907-72305929 ATGCACAAAAAGAACTGGGTTGG + Intergenic
1153075104 18:1154106-1154128 ATGAGCAGTAAGTACAGTGAAGG - Intergenic
1153261362 18:3227232-3227254 ATTAGCATCAAGAACTGTGAAGG + Intergenic
1153368596 18:4287635-4287657 TTGAACAATGAGAACAGGGAGGG + Intronic
1154450377 18:14470857-14470879 ATGAGCAATAAGACAGAGGATGG + Intergenic
1155397352 18:25400672-25400694 TTCAGGAATAAGAACTGGAAGGG + Intergenic
1157194340 18:45608507-45608529 ATGAGCAAAACGCACTGGGACGG - Intronic
1157266176 18:46224613-46224635 CTGAACAATAAGAACTGGAGTGG - Intronic
1160409619 18:78666973-78666995 AGGAGAAATGAGAACTGGGTAGG + Intergenic
1162730619 19:12716321-12716343 ATTAGCAAAAAAAACTGGGAGGG + Intronic
1163117049 19:15195328-15195350 GTGAGGAATTGGAACTGGGAGGG + Intronic
1202640000 1_KI270706v1_random:73863-73885 CTGGGAAATAAGAACGGGGAGGG - Intergenic
928913373 2:36445367-36445389 ATGAGCAATATGAAAAGAGATGG - Intronic
929597129 2:43183235-43183257 ATGAGCAATAAATGCTGGGGAGG + Intergenic
929755331 2:44759414-44759436 CTGAGCAAAAAGAACTTGGCTGG - Intronic
929854324 2:45623301-45623323 ATGAGCAATGAGCACTGTGAAGG - Intergenic
930288611 2:49465943-49465965 ATGAGCAATAAGAAATCTGAAGG - Intergenic
930530534 2:52582878-52582900 ATGAGGAATAAGAATTATGAAGG - Intergenic
930820484 2:55641656-55641678 GTGAAAAATAAGAAATGGGATGG - Intronic
933450288 2:82440949-82440971 ATAAGCAATCTTAACTGGGAGGG - Intergenic
933467894 2:82679061-82679083 AGCAACAATAAGCACTGGGAAGG + Intergenic
933608690 2:84411513-84411535 TTGAGCAAAAAGAACTAAGATGG + Intergenic
934495492 2:94793314-94793336 CTGGGAAATAAGAACAGGGAGGG - Intergenic
934657747 2:96124830-96124852 ATGCGCAGGAGGAACTGGGATGG - Intronic
935813170 2:106819646-106819668 ATGAGCAATAAGAAATCTGAAGG + Intronic
937044555 2:118844272-118844294 ATGAGCAAAAAGGAGAGGGAGGG + Intronic
937353027 2:121179222-121179244 AAGAACAATAAAAACTGGGAAGG + Intergenic
937837854 2:126491729-126491751 AAGAGCAATCAAAACTTGGAGGG + Intergenic
938111305 2:128567729-128567751 ATAAGATATAAAAACTGGGATGG + Intergenic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
941178315 2:162227735-162227757 AGGAGCAAGAAGAGCTGGCAGGG - Intronic
941320267 2:164046211-164046233 ATGAGCAATCAGAGGTGGTATGG - Intergenic
943541744 2:189224036-189224058 ATGAGAGATAACAACAGGGAAGG + Intergenic
944154710 2:196597081-196597103 ATAAACAATAAGATGTGGGAGGG - Intergenic
944770736 2:202912066-202912088 ATGAGAAAAAAAAACTGGCAAGG - Exonic
947196497 2:227573413-227573435 ATGAGGAATAAAATCTGGCAGGG + Intergenic
948330647 2:237161671-237161693 ATGAACAATGGGAGCTGGGATGG + Intergenic
1169128625 20:3150061-3150083 TTGCGCTATAAGAACAGGGAGGG - Intronic
1171290286 20:23979199-23979221 ATGAGCAATCAGGGCAGGGAAGG + Intergenic
1171406022 20:24912997-24913019 ATGAGCCATCTGAACAGGGAGGG - Intergenic
1177836855 21:26194040-26194062 ATGAGCAATGAGAGATGGGCTGG + Intergenic
1179874403 21:44260826-44260848 ATATGCAATAAGATCTGGAAAGG + Exonic
1180767142 22:18351813-18351835 ATGAGCAATCAGGGCAGGGAAGG - Intergenic
1180779168 22:18510566-18510588 ATGAGCAATCAGGGCAGGGAAGG + Intergenic
1180811888 22:18767886-18767908 ATGAGCAATCAGGGCAGGGAAGG + Intergenic
1181198044 22:21202130-21202152 ATGAGCAATCAGGGCAGGGAAGG + Intergenic
1181401702 22:22653674-22653696 ATGAGCAATCAGGGCAGGGAAGG - Intergenic
1181703660 22:24634767-24634789 ATGAGCAATCAGGGCAGGGAAGG - Intergenic
1181909662 22:26228575-26228597 AGGAGGAAGCAGAACTGGGAAGG - Intronic
1183000554 22:34855251-34855273 CTGAGAAATAGGCACTGGGAAGG - Intergenic
1203228763 22_KI270731v1_random:92707-92729 ATGAGCAATCAGGGCAGGGAAGG - Intergenic
949486853 3:4547991-4548013 ATGAGAAATAAGAAGTAGAATGG - Intronic
950281952 3:11715628-11715650 ATGAATAACAAGAACTGGGCCGG - Intronic
950878295 3:16298913-16298935 TTGATCAATAAAAACTGCGAGGG - Intronic
951028179 3:17851404-17851426 ATGAGAAATGAGAAATGAGATGG - Intronic
951597543 3:24334579-24334601 ATGAGCAATATGGTCTTGGATGG + Intronic
951853342 3:27167891-27167913 ATGAGCAAATGGAACTAGGAGGG - Intronic
952705671 3:36375377-36375399 AGGAGCAATAAGACCAGGGTTGG + Intergenic
953545163 3:43858975-43858997 ATAAGCAATAAGCACTGTGCAGG - Intergenic
955825693 3:62944790-62944812 ATGAGGACTTAGAATTGGGAGGG + Intergenic
955878174 3:63515619-63515641 CTGAGAAAAAAGAACAGGGAAGG + Intronic
956599761 3:71008271-71008293 ATGAGCATTAAAAAAAGGGAGGG + Intronic
956652571 3:71518890-71518912 ATGAGGAGAAAGAACTGGCAAGG + Intronic
956784212 3:72628784-72628806 ATGAGCAATGTGAACTTTGATGG - Intergenic
958666819 3:97150731-97150753 GTGAGCACCAAGAACTGTGAAGG - Intronic
959832965 3:110886354-110886376 ATGAGCACTGTGAACCGGGAGGG + Intergenic
961628658 3:128280805-128280827 ATGAGCAGAAACAGCTGGGAGGG - Intronic
961696993 3:128712189-128712211 ATAGGCAATAAGAAGTGTGATGG - Intergenic
962185379 3:133253585-133253607 GTAAGCAGTAACAACTGGGATGG - Intronic
963411527 3:144933396-144933418 GTGAGCAATAAGAAATCTGATGG + Intergenic
963650115 3:147968756-147968778 AAGAGAAATAAAAACTGGAAAGG - Intergenic
963865398 3:150355349-150355371 AGGAGCAAGAACAAGTGGGATGG - Intergenic
966070855 3:175876114-175876136 ACGTGCAATCAGAACTGGGATGG + Intergenic
967320246 3:188188266-188188288 AGGAGCAGTAAGAATTGGGAGGG + Intronic
969903940 4:10375621-10375643 AAGAGAAAAAAGAACAGGGAAGG - Intergenic
970010264 4:11450839-11450861 ATGAACAAGGAGAACTGAGAAGG - Intergenic
970379049 4:15488162-15488184 ATGAGCAATAAGAAATCTGAAGG - Intronic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
970407211 4:15775211-15775233 TTCAGCAAAGAGAACTGGGAAGG - Intergenic
970808643 4:20065171-20065193 ATGAGAAATAATTACTGGGAAGG + Intergenic
972201744 4:36720959-36720981 ATGAGGAAAAACACCTGGGATGG - Intergenic
973786844 4:54340435-54340457 AAGAGTAATAAGAACTAGAAAGG + Intergenic
976688505 4:87842874-87842896 ATGGGCTATGAAAACTGGGAAGG + Intronic
977157994 4:93597592-93597614 ATGAACAATAGGGACAGGGATGG - Intronic
979549305 4:121972698-121972720 ATGACCAATAAAAACAGAGAGGG - Intergenic
980844813 4:138312042-138312064 ATGAGAAATAGTAACTGGCATGG + Intergenic
980866875 4:138562437-138562459 AAGAACAATAAGAGCTGGGTTGG + Intergenic
981517672 4:145627551-145627573 TTGAGCAATGAGAATTGGTAAGG + Intronic
981588968 4:146335606-146335628 ATGACCAATATCAACTGGGTTGG - Intronic
982009466 4:151092836-151092858 ATGAGGAAAAAGACCTGGAAAGG + Intergenic
982108327 4:152030527-152030549 TTGTGCAATAACAACTTGGATGG - Intergenic
983547289 4:168977560-168977582 TTGAGCAATAAGGAATGGAAGGG - Intronic
984276173 4:177612628-177612650 CTGGGCAAAAGGAACTGGGAAGG + Intergenic
986466046 5:8025502-8025524 ATGAGGACTAAGAGGTGGGATGG - Intergenic
987758445 5:22127158-22127180 ATGAGCTATAAGAAGAGAGAAGG + Intronic
988100738 5:26674026-26674048 AAGACCGAAAAGAACTGGGATGG + Intergenic
988188000 5:27891364-27891386 ATGAGCAATAAGAATTCTCATGG - Intergenic
988320441 5:29687909-29687931 ATCAGCATTAAGAACTCTGAAGG - Intergenic
988640090 5:33032340-33032362 ATGAGCAATAGCAACTGGGGAGG - Intergenic
988718718 5:33854629-33854651 ATGACCAATTAGAGATGGGAGGG - Intronic
989131486 5:38111552-38111574 ATGTGCAAAATGAACTGGGGGGG - Intergenic
989334185 5:40296046-40296068 ATAAGCCATTAGAACTGGAATGG - Intergenic
991653646 5:68881848-68881870 ATGAGGAATAAGATTTGGGAGGG - Intergenic
991749202 5:69781295-69781317 ATGAGCTATAAGAAGAGAGAAGG + Intergenic
991800783 5:70361106-70361128 ATGAGCTATAAGAAGAGAGAAGG + Intergenic
991827817 5:70648935-70648957 ATGAGCTATAAGAAGAGAGAAGG - Intergenic
991893146 5:71360547-71360569 ATGAGCTATAAGAAGAGAGAAGG + Intergenic
991932023 5:71762879-71762901 ATGACCCATATGAACTCGGATGG - Intergenic
993400550 5:87445011-87445033 ATGAGCAAGAAGAAATGTCAAGG + Intergenic
994217644 5:97157225-97157247 ATGAGCAATAAGAAATCTGAAGG - Intronic
995098064 5:108263046-108263068 GTGAGTAATGAGAACTGAGATGG - Intronic
995484351 5:112624787-112624809 CTGAGCAAAAAGAACAGAGATGG + Intergenic
995504635 5:112847050-112847072 ATGAGCATTATGAAATTGGATGG - Intronic
996196979 5:120620784-120620806 ATCAGCAAAAAGAGCTGGGATGG - Intronic
997410097 5:133684412-133684434 AGAAGCAACAAGTACTGGGAGGG - Intergenic
997834504 5:137181395-137181417 ATCAGCAATGAGGACTAGGATGG + Intronic
1000796604 5:165672079-165672101 ATGAGCACTAGCATCTGGGAAGG - Intergenic
1003458813 6:6310014-6310036 ATTTGCAATGAGAACTAGGATGG - Intronic
1004804933 6:19193028-19193050 AAGAGAAATAATAACTGGGCAGG - Intergenic
1006884142 6:37366387-37366409 ATGAGAAATAACAACAGAGAGGG - Intronic
1007322138 6:41035025-41035047 ACCAGCAGTAGGAACTGGGAGGG + Exonic
1007561121 6:42809137-42809159 TTGAACAATGAGAACAGGGAGGG - Intronic
1007796389 6:44351844-44351866 AAGATGAATAAGAACTGTGAGGG + Intronic
1011266996 6:85532413-85532435 ATGAGACATAGGAATTGGGAGGG - Intronic
1011504792 6:88029518-88029540 AGGAGCAAGAAGGAGTGGGAGGG + Intergenic
1012390213 6:98729669-98729691 ATGAGCAAGGAGGATTGGGAAGG + Intergenic
1012591166 6:100983286-100983308 AAAAGGAATAAGAACTGGAAAGG - Intergenic
1013189630 6:107791156-107791178 CAGAGCAAGAAGAACAGGGATGG + Intronic
1014398430 6:120955957-120955979 ATGAGCAGAATTAACTGGGAAGG + Intergenic
1015378631 6:132539886-132539908 ATGAGCAGGAAGAACTGCCAGGG - Intergenic
1016548682 6:145252923-145252945 GGGAGCAATAAGAAATGAGATGG - Intergenic
1018571897 6:165220655-165220677 ATGAGCAATGATAAATTGGAAGG + Intergenic
1020594647 7:10190609-10190631 ATGATGAATAAGAACTTGGAAGG + Intergenic
1023041504 7:36176803-36176825 GTGAGGAAAAAGAAGTGGGAGGG + Intronic
1023996429 7:45161700-45161722 AGGAGGAAGAAGAACTGGGCTGG + Intronic
1024710468 7:52009704-52009726 CTGCACAGTAAGAACTGGGAGGG + Intergenic
1026537772 7:71254348-71254370 ATCAGGAAAAAGACCTGGGAAGG + Intronic
1027978093 7:85184931-85184953 ATGAGCAAGAAGATCGGGGTTGG - Intronic
1031159289 7:118146606-118146628 CTGAAGAATAAGACCTGGGAAGG + Intergenic
1031239277 7:119217664-119217686 CTGAACAATCAGAAGTGGGAAGG - Intergenic
1032232471 7:130087172-130087194 AGTAACAAAAAGAACTGGGAAGG - Intronic
1033481456 7:141745838-141745860 CTCAACAATAAGTACTGGGATGG - Intronic
1034066785 7:148144613-148144635 ATGAGTATCAAGAACTGGGAAGG - Intronic
1034727581 7:153352753-153352775 ATGAGCAATAATATTTTGGAAGG - Intergenic
1035946221 8:3965932-3965954 ATAAGAAATAAGAACTGTCAAGG + Intronic
1038182800 8:25244687-25244709 ATGAGAAAGAAGAGATGGGAAGG + Intronic
1038525052 8:28265799-28265821 AAAAGAAAAAAGAACTGGGATGG + Intergenic
1039331654 8:36543827-36543849 ATGAGCAAAAAGAACAAGGCTGG + Intergenic
1040101180 8:43507345-43507367 CTGGGAAATAAGAACGGGGAGGG + Intergenic
1040648060 8:49421937-49421959 CTAAGCAAGAAGATCTGGGAAGG - Intergenic
1041833881 8:62189120-62189142 AATAGCAATTAAAACTGGGAAGG + Intergenic
1042599593 8:70485436-70485458 TGGAGCAATGAGAAATGGGAGGG + Intergenic
1042876080 8:73441017-73441039 GTGAGCCATGTGAACTGGGAGGG - Intronic
1042899422 8:73707544-73707566 GTGAGCCATAAGAAATGTGATGG + Intronic
1043315811 8:78920294-78920316 AGGAGAAAGAAGAACTAGGAAGG + Intergenic
1044931071 8:97252095-97252117 AGCAGCAATAAGAGCTGGCATGG - Intergenic
1045803767 8:106132617-106132639 AAGAGCAAGAAGACATGGGAAGG + Intergenic
1045876986 8:106993058-106993080 ATCAGCAATCAGAATAGGGAGGG + Intergenic
1046260444 8:111760066-111760088 ATGAGAAATAAGAATTAGGTAGG - Intergenic
1046426401 8:114056816-114056838 ATGTGCATTTAGAACTGGGATGG - Intergenic
1048487290 8:134859983-134860005 CAGAGCAATAAATACTGGGAAGG + Intergenic
1051673177 9:19532832-19532854 ATGACCCATTAGAACTAGGAAGG - Intronic
1052685041 9:31744817-31744839 ATGAGTATTAGGAACTGGGCTGG - Intergenic
1053661641 9:40287056-40287078 CTGGGAAATAAGAACAGGGAGGG + Intronic
1054373762 9:64433289-64433311 CTGGGAAATAAGAACAGGGAGGG + Intergenic
1054522967 9:66089228-66089250 CTGGGAAATAAGAACAGGGAGGG - Intergenic
1055804760 9:80080132-80080154 ATGGGCATTAAGAATTGGGGTGG + Intergenic
1056587162 9:87936188-87936210 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1056609713 9:88116755-88116777 CTGGGAAATAAGAACGGGGATGG + Intergenic
1057258670 9:93571063-93571085 ATGAGCAATAAGAACCTACATGG + Intergenic
1057375169 9:94514674-94514696 AGATGCAATATGAACTGGGAAGG + Intergenic
1058638996 9:107064866-107064888 ATGAGCACTCAGATCTGAGAGGG - Intergenic
1059520453 9:114935984-114936006 ATGAAGAATATAAACTGGGAAGG + Intergenic
1061831457 9:133298758-133298780 ATGAGCAAAAAGGACAGGCATGG + Intergenic
1062574128 9:137198701-137198723 ATGAGCCACAACAACTGGCAAGG + Intronic
1203548114 Un_KI270743v1:144594-144616 CTGGGAAATAAGAACGGGGAGGG - Intergenic
1186372093 X:8957321-8957343 ATTAGTAATAATAACTTGGAGGG + Intergenic
1186602069 X:11048891-11048913 ATGAGTAATGAGAACTCAGAGGG - Intergenic
1186948361 X:14594766-14594788 CTGAGCAATAGTAGCTGGGAAGG - Intronic
1187380442 X:18796961-18796983 AAGAGCCTTAAGAAGTGGGAGGG + Intronic
1187538419 X:20165592-20165614 ATGAGCCATAAGAACAGTAAGGG + Intronic
1188251215 X:27897180-27897202 ATGAGCAAAAAGAACAAAGATGG + Intergenic
1189206391 X:39242911-39242933 ATGAGCAAGCAGAAATTGGAAGG - Intergenic
1191669635 X:63737244-63737266 GTCAGTAATAAAAACTGGGATGG + Intronic
1195239949 X:102941046-102941068 ATGAGCAATGAGGACTGAGGTGG - Intergenic
1195324620 X:103748163-103748185 AGGAGCAATAAGAAAGGAGAAGG + Intergenic
1195883065 X:109612763-109612785 ATGAGTAATAAAAGGTGGGATGG - Intergenic
1197841939 X:130757545-130757567 TTGAAACATAAGAACTGGGAAGG - Intronic
1198430587 X:136562809-136562831 ATGAGCAATAAGAAGTCTGAAGG - Intergenic
1200165916 X:154035121-154035143 AAGAGCTCTAAGAACTGCGATGG + Intronic
1201335579 Y:12877400-12877422 ATGAAAAATAAGTGCTGGGAAGG + Intergenic
1201912669 Y:19149101-19149123 TTGAGCAATAAAAAATTGGAAGG - Intergenic
1201961239 Y:19682628-19682650 TTGAGCAAGAAAAACAGGGAGGG - Intergenic