ID: 903056226

View in Genome Browser
Species Human (GRCh38)
Location 1:20638043-20638065
Sequence GGTACCAGTGCACCAGGAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903056222_903056226 -8 Left 903056222 1:20638028-20638050 CCAGGGAGAGGCCCAGGTACCAG 0: 1
1: 1
2: 1
3: 46
4: 352
Right 903056226 1:20638043-20638065 GGTACCAGTGCACCAGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 180
903056214_903056226 23 Left 903056214 1:20637997-20638019 CCTGGAGGTGACAAAGAGCACCG 0: 1
1: 0
2: 0
3: 9
4: 121
Right 903056226 1:20638043-20638065 GGTACCAGTGCACCAGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 180
903056220_903056226 3 Left 903056220 1:20638017-20638039 CCGGGTTGCTTCCAGGGAGAGGC 0: 1
1: 0
2: 1
3: 24
4: 246
Right 903056226 1:20638043-20638065 GGTACCAGTGCACCAGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 180
903056212_903056226 30 Left 903056212 1:20637990-20638012 CCCAGAACCTGGAGGTGACAAAG 0: 1
1: 0
2: 1
3: 27
4: 272
Right 903056226 1:20638043-20638065 GGTACCAGTGCACCAGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 180
903056213_903056226 29 Left 903056213 1:20637991-20638013 CCAGAACCTGGAGGTGACAAAGA 0: 1
1: 0
2: 2
3: 59
4: 368
Right 903056226 1:20638043-20638065 GGTACCAGTGCACCAGGAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903056226 Original CRISPR GGTACCAGTGCACCAGGAGA AGG Exonic
900428731 1:2592286-2592308 GGCACCAGTGCCTCAGGGGAGGG - Intronic
900428773 1:2592404-2592426 GGCGCCAGTGCATCAGGGGAGGG - Intronic
900428831 1:2592565-2592587 GGTGCCAGTGCATCAGGGGAGGG - Intronic
900649581 1:3724254-3724276 GGTACCAGGCCCCCAGGGGAAGG + Intronic
900743354 1:4343703-4343725 GGAACCATTGCAACAGGGGAGGG - Intergenic
902204769 1:14860075-14860097 GGTACCATTGCAACAGTAGCAGG + Intronic
902227709 1:15007253-15007275 GGAACCAGAGCACTAGGTGAGGG + Intronic
903056226 1:20638043-20638065 GGTACCAGTGCACCAGGAGAAGG + Exonic
903701016 1:25247989-25248011 GGTACCGCGGCGCCAGGAGAAGG + Intronic
907696455 1:56734773-56734795 GGTACAAGTGCACAATGTGAAGG - Intronic
908603798 1:65771182-65771204 GGAACCTGTGTACCAGCAGAGGG - Intergenic
912500027 1:110115504-110115526 TGTACCAGTGCACCTGTTGAAGG + Intergenic
915451970 1:156011859-156011881 TCTACCAGTGCACCTGGACAGGG - Exonic
915586397 1:156846051-156846073 GCTTCCAGCGCACCAGGAGGTGG + Exonic
917625268 1:176839625-176839647 GTCTTCAGTGCACCAGGAGAGGG + Intronic
917737291 1:177932693-177932715 GGTACCTCTGCCCCTGGAGAAGG + Exonic
919230201 1:194763913-194763935 GGTAACTGTGCACTAGGGGAAGG - Intergenic
921620797 1:217324206-217324228 GGTAACAGAGCTCCAGGTGATGG - Intergenic
1065117466 10:22496760-22496782 GGTGCCAGTGCAGCTTGAGAAGG - Intergenic
1065941912 10:30572578-30572600 GGTACCAGTCTACCAAGAGTAGG - Intergenic
1067345478 10:45435122-45435144 GGTACAAGAGCTCAAGGAGATGG + Intronic
1068637224 10:59361021-59361043 AGTACCTGTGCACCTGGAGCAGG + Intronic
1068927891 10:62558916-62558938 GGTGTGAGTGCAGCAGGAGAGGG + Intronic
1070892519 10:79952291-79952313 GGCACAAGTGCACCTGGGGATGG - Intronic
1073634201 10:105180728-105180750 GGCACCAGTGCATCAGAAAAGGG - Intronic
1074261340 10:111856482-111856504 TGGATCAATGCACCAGGAGAAGG - Intergenic
1075723494 10:124600312-124600334 GGCACCAGTGCCCCAGGGCAGGG - Intronic
1077743172 11:4870180-4870202 GGTACAAGTGCACAACGAGCAGG - Intronic
1079384725 11:19968742-19968764 TCTATCAGTGCACCAGGAGCTGG - Intronic
1081126387 11:39328688-39328710 GGTACCAGTGCACAACGTGCAGG + Intergenic
1084328425 11:68415198-68415220 GGTACCAGTGCACTGAGAGGAGG + Intronic
1084428255 11:69097328-69097350 GGTAGCAATGCTCCAGGTGAGGG + Intergenic
1084484085 11:69437987-69438009 GGCCCCAGTGCAGCAAGAGAGGG - Intergenic
1084834210 11:71791174-71791196 GGGACTAGTGCAGCAGGACAGGG - Intronic
1084898575 11:72293384-72293406 GGCACCACTGCACCCTGAGAAGG - Exonic
1085502134 11:77034077-77034099 CGTACCTGTGCTCCTGGAGAAGG - Intergenic
1086996980 11:93369091-93369113 GCTATCTGTGAACCAGGAGAAGG - Intronic
1091044653 11:132314803-132314825 GGTATCAGTGGACATGGAGAGGG + Intronic
1091150374 11:133323136-133323158 GGTAGGAGTGAAACAGGAGATGG - Intronic
1091394182 12:143480-143502 GCTACCAATGCACTAAGAGATGG - Intronic
1093622928 12:21313646-21313668 GGTTTCAGTGAACCGGGAGATGG + Intronic
1095813933 12:46400884-46400906 GGCACCAGTGCACAAGGGGCAGG + Intergenic
1096581818 12:52590579-52590601 GGTAGGATTACACCAGGAGAGGG - Intronic
1098399197 12:70055145-70055167 GGTTCAAGTGCTTCAGGAGAAGG - Intergenic
1098589228 12:72190220-72190242 GGTAACACTGCAACAGGAGTAGG - Intronic
1099568726 12:84285690-84285712 GGTGCCAGAGAACAAGGAGAGGG + Intergenic
1102905723 12:116673878-116673900 AGAACCAGTGAAGCAGGAGACGG - Intergenic
1103359504 12:120345579-120345601 GGTACCACTGAAGCAGGGGACGG - Exonic
1103669859 12:122604703-122604725 GGCACCAGGGCAGCATGAGAAGG - Intronic
1103864720 12:124042772-124042794 GGGACCCCTGCACCAGGCGAAGG + Intronic
1104104036 12:125642110-125642132 GGAAGCATTGCACTAGGAGAAGG - Intronic
1104604318 12:130176807-130176829 GGTACATGTGCACCACGTGAAGG + Intergenic
1104685574 12:130782158-130782180 GGAACCAGGGCAGCAGCAGAGGG - Intergenic
1104840714 12:131824031-131824053 GGTACCAGTGCATGAGGACTTGG + Intergenic
1105023524 12:132833865-132833887 GGGAACAGTGTCCCAGGAGAGGG + Intronic
1105746262 13:23379459-23379481 GATGCCAGTGCAGAAGGAGAGGG - Intronic
1105895505 13:24714382-24714404 GGAGCCAGTACACCAGTAGAGGG + Intergenic
1106033155 13:26020625-26020647 GGGCCGAGTGCACCTGGAGAGGG - Exonic
1106109902 13:26767610-26767632 CGCATCAGAGCACCAGGAGATGG + Intergenic
1108501078 13:51070477-51070499 GGGACCACTGCACCTGGAGAAGG - Intergenic
1108685641 13:52816583-52816605 GGAAACAGTCCAGCAGGAGAGGG + Intergenic
1111987252 13:95077857-95077879 GGTACCAGTGTGCCAAGACATGG + Intronic
1114749727 14:25189505-25189527 GGTACACGTGCACAAGGTGAAGG - Intergenic
1119261759 14:73241898-73241920 GGAAACAGTGCAGCAGGAAAGGG + Intronic
1122473656 14:101990399-101990421 GGCACCAGGGACCCAGGAGAAGG + Intronic
1122921727 14:104883045-104883067 GGGACCAGTGCAGCAGGACGGGG + Exonic
1125015697 15:34932365-34932387 GGTAACAGTGAACCAGAAGGTGG + Exonic
1125954185 15:43777738-43777760 GGTCTCAGTGCACCAGGATCTGG - Intronic
1126897360 15:53273277-53273299 GATTCCAAAGCACCAGGAGAAGG - Intergenic
1129984716 15:79908036-79908058 GCTACCAGGGCACCAGGACCGGG + Intronic
1130297859 15:82659823-82659845 GGTACTAGGCCACCAGTAGAGGG - Exonic
1132399420 15:101496390-101496412 GGGACCAGGGCACCAAGGGAGGG - Intronic
1133044153 16:3076809-3076831 GGTGCCCCTGCACCAGGAAAGGG - Intronic
1134121053 16:11585753-11585775 AGCACCAGTGCACCAGGCCAAGG + Intronic
1137705310 16:50531564-50531586 GTTACCTGTGCACCAGGCGCTGG - Intergenic
1139325091 16:66146324-66146346 GTTCTCAGAGCACCAGGAGAAGG - Intergenic
1142197674 16:88746233-88746255 GGGACCAGTGAAGCTGGAGAGGG + Intronic
1143813408 17:9491080-9491102 GGTACCAGAGCTCAGGGAGAGGG - Intronic
1144705387 17:17364410-17364432 GGTACAAGAGCACCACGAAAGGG - Intergenic
1145314708 17:21722766-21722788 GCTACCAGTTCCCCGGGAGAGGG - Intergenic
1146837785 17:36126122-36126144 GGGACCAGGGCACCTGGAGATGG - Intergenic
1147166804 17:38597880-38597902 GCTGCCAGTGGACCAGGAGGGGG + Intronic
1147167090 17:38599366-38599388 GGATCCAGTGCTCCGGGAGAGGG - Intronic
1152573333 17:81129919-81129941 GGAACCTGTCCTCCAGGAGATGG + Intronic
1156348298 18:36279283-36279305 GGTACCACTGCACCAGAGGCTGG + Intergenic
1156746786 18:40402073-40402095 AGTACCAATGCACCTGGGGAGGG + Intergenic
1157719730 18:49914424-49914446 GGCAGAAGTGCTCCAGGAGAAGG - Intronic
1161655231 19:5510362-5510384 GATAGCAGTGCACCTGGAAAAGG + Intergenic
1162737589 19:12755139-12755161 GGTAAGAGTGCACCTGGTGAGGG - Intronic
1163225393 19:15957088-15957110 TGTACCACTGCACCAGGTCAGGG - Intergenic
1163249681 19:16119071-16119093 GGGAGCAGTGTGCCAGGAGATGG + Intronic
1163365347 19:16873030-16873052 GGTACGAGTGACCCAGGAAACGG - Intronic
1163527999 19:17832887-17832909 GGTGCCAGGGCACCAGGTGTGGG + Exonic
1163817903 19:19478206-19478228 GGTGCCAGTGCTTCAGGAAAAGG - Intronic
1164200195 19:23011769-23011791 GGTAACAGTGCACTGGGAAAAGG - Intergenic
1166745228 19:45138669-45138691 GGAACCAGCCCAGCAGGAGAGGG + Intronic
1167676914 19:50892951-50892973 GGTACCAGGGCCTCAGGAGGTGG + Intergenic
1167974634 19:53215123-53215145 TCTACCAGTTGACCAGGAGATGG + Intergenic
1168406814 19:56114785-56114807 GGTACCAGGGCAGCAGGTGCTGG - Intronic
926038536 2:9654472-9654494 GGGCCCAGTTCTCCAGGAGAAGG + Intergenic
927687191 2:25179200-25179222 AGTCCCATTGCCCCAGGAGAGGG + Intergenic
927860156 2:26555693-26555715 GGTTCCAGTCTGCCAGGAGAAGG - Intronic
927908739 2:26881278-26881300 GGTATCACTGCCCCAGAAGAAGG + Intronic
928132586 2:28663575-28663597 TGTCCCAGGGCACCAGCAGAGGG + Intergenic
932434034 2:71692676-71692698 GGTAAAAGTGCTCCAGGGGAGGG - Intergenic
932595310 2:73089605-73089627 GGTCTCTGAGCACCAGGAGAAGG - Intronic
933789513 2:85872750-85872772 GGTACCCGTGCACCTAGACAGGG + Intronic
937077522 2:119117821-119117843 GGCTCCAGGTCACCAGGAGAGGG - Intergenic
941476555 2:165957143-165957165 GGCACGAGTCCACCGGGAGAGGG + Intergenic
941744074 2:169067826-169067848 GGGACCATTGGACAAGGAGAGGG + Intronic
941841399 2:170088474-170088496 TGTACAAGTGCACCAGGAAAGGG - Intergenic
942931586 2:181500561-181500583 GGTACCATGGTACCAGGAGTGGG + Intronic
943291570 2:186078749-186078771 GGTACCTGTGCACCACGTGCAGG - Intergenic
945453629 2:210023034-210023056 GGTACCAGTGTACCAGAGAATGG - Exonic
946155409 2:217803724-217803746 GGTGGCAGTGCAGCAGGGGAGGG - Exonic
947702527 2:232246419-232246441 GTTGCCAGTGCCCCGGGAGAGGG + Intronic
948141913 2:235679711-235679733 GGTGCCAGCCCTCCAGGAGAAGG - Intronic
1171889844 20:30700610-30700632 GGTACATGTGCACAAGGTGAAGG - Intergenic
1172093660 20:32450377-32450399 GGTACTAGTGCTCAAGGACAGGG + Intronic
1172654090 20:36526308-36526330 GGCAGCAGGGCCCCAGGAGAAGG - Intronic
1173115716 20:40241053-40241075 GCAACCGGTGCACAAGGAGAGGG - Intergenic
1173235634 20:41243105-41243127 GTTCCCAGTGCTCCAAGAGAGGG + Intronic
1173255571 20:41392348-41392370 GGGGCCAGTGCAGCAGGAGAGGG + Intergenic
1173369153 20:42419381-42419403 AGTACCAGGGCAGCAGGGGAAGG + Intronic
1173384396 20:42574542-42574564 GTTACCATTGCTCCAGGGGATGG + Intronic
1174102677 20:48139155-48139177 GGTCCCAATGCCCCAGGAGAGGG + Intergenic
1179441829 21:41400196-41400218 GGTGCCAGGGGACCAGGGGAGGG + Intronic
1182996054 22:34813379-34813401 GTCATCAGTGCACCCGGAGAGGG - Intergenic
1183757187 22:39779252-39779274 GGTTGCAGTGAACCAGGAGGCGG + Intronic
949925622 3:9038746-9038768 GGAACCAGGGCATAAGGAGAAGG - Intronic
951055617 3:18143270-18143292 GGGCACAGGGCACCAGGAGAGGG - Intronic
952098973 3:29989387-29989409 TGCACCTGTGCATCAGGAGAGGG - Intronic
952880937 3:37986023-37986045 AGAATCACTGCACCAGGAGAGGG - Intergenic
954898442 3:53997250-53997272 GGTGCCAGTGGAAAAGGAGACGG - Intergenic
956169129 3:66419102-66419124 GGTATCAGGGCGCCAGGAAAAGG + Intronic
957498767 3:81026170-81026192 GGTACATGTGCACAAGCAGAGGG - Intergenic
960820894 3:121730036-121730058 GTTGCCAGTGCACCAGGAAAAGG + Intronic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
966040844 3:175485944-175485966 GCTATCTGTGGACCAGGAGATGG + Intronic
969570620 4:8006169-8006191 GGAAGCAGTGCACGAGGTGAAGG + Intronic
970398568 4:15696021-15696043 GGCATGAGTGCAGCAGGAGAGGG - Intronic
973041041 4:45471351-45471373 GGTGGCAGTGCACCCAGAGAGGG - Intergenic
973873383 4:55188911-55188933 GGTACAAGTCCAGCAGGGGAAGG - Intergenic
975736901 4:77389707-77389729 GGTTCCAGGGCAGCAGGAGGAGG + Intronic
978249022 4:106608842-106608864 GGTACCAGTGCCCAATGAGTTGG + Intergenic
982089297 4:151866638-151866660 GGAAGCAGTGGACCAGAAGAGGG + Intergenic
983526306 4:168763623-168763645 GGTACCACAGCAGCAGGAGGTGG + Intronic
983790834 4:171795272-171795294 GGTACCAGTGAAGCAGGGGTGGG + Intergenic
985105367 4:186494045-186494067 GCTACCAGTGAGCCAGGAGCAGG + Intronic
985290338 4:188380237-188380259 GGGACAGGTGCACCAGGACATGG + Intergenic
985290352 4:188380287-188380309 GGGACAGGTGCACCAGGACACGG + Intergenic
986016850 5:3764963-3764985 GTCACCTGTGCACCCGGAGAAGG - Intergenic
990856573 5:60274002-60274024 GGTCTCAGGGCATCAGGAGATGG + Intronic
995277894 5:110298323-110298345 GGGACCAGGGCAACACGAGATGG + Intronic
996607007 5:125335031-125335053 AGCACCAAAGCACCAGGAGATGG + Intergenic
1001310496 5:170606839-170606861 GGAACCAGAGCAGCAGAAGAAGG - Intronic
1001314227 5:170631381-170631403 GGTACCACTGCCCCAGGAAGGGG + Intronic
1006925521 6:37652224-37652246 GGATGCAGTGCCCCAGGAGAAGG - Exonic
1006984488 6:38167865-38167887 GGAACCAGTGAGCCAGGAGGCGG - Intergenic
1009766891 6:68089292-68089314 AGGAGCAGTGCACCTGGAGAAGG - Intergenic
1011030626 6:82919026-82919048 GTTACCAAAACACCAGGAGATGG - Intronic
1013393795 6:109713802-109713824 GGTGCCAGTCCACCAGCACAGGG + Intronic
1013419391 6:109952137-109952159 GGTGACAGTGCATCAGGAGAAGG + Intergenic
1015551337 6:134415075-134415097 TGTACCAATGTACCAGAAGAAGG - Intergenic
1015926926 6:138320147-138320169 GGTACCTGTGCATTAGGAGAAGG + Intronic
1018559730 6:165089171-165089193 AGTCCCAGGGCACCAGGAGCAGG - Intergenic
1019575159 7:1734233-1734255 GGGACCAGTGTTCCTGGAGAGGG + Intronic
1019643516 7:2117013-2117035 GCTCCCAATGCAGCAGGAGAGGG + Intronic
1020212624 7:6167499-6167521 GGCACCAGTGCAGCTGGAGCGGG - Intronic
1021722860 7:23520753-23520775 GGTTGCAGTGAACCAAGAGATGG - Intronic
1023700818 7:42890501-42890523 CATACCAGTGCTCCTGGAGAAGG - Intergenic
1026775674 7:73229715-73229737 GGTTCCTGAGCACCAGGGGAAGG - Intergenic
1027016532 7:74783087-74783109 GGTTCCTGAGCACCAGGGGAAGG - Intronic
1027071496 7:75162849-75162871 GGTTCCTGAGCACCAGGGGAAGG + Intergenic
1032377553 7:131437107-131437129 GGTACCTGTGCACAATGTGAAGG + Intronic
1034387954 7:150756165-150756187 GGTTCCACTGCACAAGGAGCAGG + Intergenic
1034818731 7:154197393-154197415 GGTATCAGTGCACCAAGCTAGGG - Intronic
1035114102 7:156508151-156508173 GGTACCAGAGCACCTGGAGATGG + Intergenic
1045393051 8:101734085-101734107 GTTAGCAGTGCCCCAGGAGCAGG + Intronic
1046219272 8:111192480-111192502 GGCATCAGTGGAGCAGGAGAGGG + Intergenic
1046975890 8:120276793-120276815 GGTACCTGTGCACAATGTGAAGG - Intronic
1047351371 8:124077961-124077983 GATACCAGGGCACCAGGGGTTGG - Intronic
1049294135 8:141821252-141821274 AGAACCAGTGCACAAGGAGGAGG + Intergenic
1051315351 9:15823283-15823305 GGTACAAGTGCACAACGTGAAGG - Intronic
1052710502 9:32049915-32049937 GGTACATGTGCACCACGTGAAGG + Intergenic
1055082742 9:72283097-72283119 AGCAGCAGTACACCAGGAGAGGG + Intergenic
1055374862 9:75637666-75637688 GGTTCCAGTGCACTAGTAGATGG + Intergenic
1056996933 9:91471545-91471567 GGTACCTGTGCACAACGAGCAGG + Intergenic
1059786568 9:117592780-117592802 TGTGCCTGTGCTCCAGGAGAAGG + Intergenic
1185737353 X:2503638-2503660 GGTCCCAGTGTTGCAGGAGAGGG - Intergenic
1198692647 X:139301076-139301098 GGGAGGAGTGCGCCAGGAGAGGG - Intergenic
1199218595 X:145290296-145290318 GGTACCAGCGCTGCAGAAGAGGG + Intergenic