ID: 903056505

View in Genome Browser
Species Human (GRCh38)
Location 1:20639853-20639875
Sequence GAACCCAGGGTTACACAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903056505_903056511 -6 Left 903056505 1:20639853-20639875 CCGGCCTGTGTAACCCTGGGTTC 0: 1
1: 0
2: 1
3: 8
4: 220
Right 903056511 1:20639870-20639892 GGGTTCCTTGTGGGTGTTCCAGG 0: 1
1: 0
2: 2
3: 15
4: 162
903056505_903056512 -2 Left 903056505 1:20639853-20639875 CCGGCCTGTGTAACCCTGGGTTC 0: 1
1: 0
2: 1
3: 8
4: 220
Right 903056512 1:20639874-20639896 TCCTTGTGGGTGTTCCAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903056505 Original CRISPR GAACCCAGGGTTACACAGGC CGG (reversed) Intronic
900486985 1:2927478-2927500 GAACCAAGGCTTTCTCAGGCGGG - Intergenic
900600601 1:3501199-3501221 GAAGCCAGGGAGGCACAGGCAGG + Exonic
900607340 1:3529745-3529767 CAGCCCAGGACTACACAGGCAGG + Intronic
900915260 1:5633004-5633026 GAAGCCAAGGTGACACAGGATGG - Intergenic
901186326 1:7375673-7375695 GTCCCCATGGTTACCCAGGCTGG + Intronic
901378526 1:8857017-8857039 GAATCCAGAGTCACACAGCCTGG + Intergenic
902706297 1:18207514-18207536 AAATCCAGGGTTACAAAGTCAGG + Intronic
903056505 1:20639853-20639875 GAACCCAGGGTTACACAGGCCGG - Intronic
907391953 1:54163935-54163957 GAACCCAGAGTAAGGCAGGCTGG + Intronic
907657190 1:56356271-56356293 GTATACAAGGTTACACAGGCAGG + Intergenic
908173446 1:61530472-61530494 TTACCCAAGGTTACACAGCCAGG + Intergenic
910138559 1:83999992-84000014 GAACCCAGCGTGACAGAAGCAGG - Intergenic
912385141 1:109267738-109267760 GAGCCCAGGAACACACAGGCTGG - Intronic
912605229 1:110982815-110982837 GAACTCATAGTTTCACAGGCAGG + Intergenic
916527857 1:165628529-165628551 GAAAGCAGGGATACAGAGGCAGG + Intergenic
918512180 1:185323326-185323348 GTAGCTGGGGTTACACAGGCAGG - Intergenic
919989784 1:202701899-202701921 TTGCCCAGGGTCACACAGGCAGG + Intronic
922346975 1:224704412-224704434 AAACCCAGGGATCCAGAGGCAGG + Intronic
923978389 1:239291537-239291559 GACCCCAGGTATACACATGCAGG + Intergenic
924465350 1:244294476-244294498 GAACCCAGGCTTCCAAAGCCAGG + Intergenic
1063367271 10:5498970-5498992 GCAGCCAGGGGGACACAGGCGGG + Exonic
1064186556 10:13167107-13167129 CAAGACAGGGTCACACAGGCTGG - Intronic
1066446837 10:35491463-35491485 GAACACATGCTTACACTGGCAGG - Intronic
1067431000 10:46245822-46245844 CTACCCAGGGTCACACAGCCAGG - Intergenic
1067442408 10:46316406-46316428 CCACCCAGGGTCACACAGCCAGG + Intronic
1068968944 10:62943168-62943190 GAAGCCAGGTTTACTAAGGCAGG + Intergenic
1069874699 10:71554563-71554585 GAACCCAGGGCTGCAGGGGCTGG - Intronic
1073083188 10:100872568-100872590 GAACCCAGAGTTATGCAGCCTGG - Intergenic
1074998284 10:118776348-118776370 GACTCCAGGGTTATACAGGAGGG + Intergenic
1075369338 10:121921721-121921743 GAAAGCAGGGATACAGAGGCAGG - Intronic
1075395890 10:122126796-122126818 AAACCCAGGATTCTACAGGCTGG - Intronic
1075676628 10:124300290-124300312 TAGGCCAGGGTGACACAGGCTGG + Intergenic
1076142593 10:128091644-128091666 GAACCCAGGGGAACAGAGGTTGG + Intergenic
1076544400 10:131235083-131235105 GGGCCCAGGGTACCACAGGCAGG + Intronic
1076752727 10:132551772-132551794 GGACCCAGGGGGACAGAGGCAGG + Intronic
1076995285 11:294681-294703 GAACCCAGGGTGACCCAGAGGGG - Exonic
1077271151 11:1682129-1682151 GGCCCCAGGGAAACACAGGCTGG + Intergenic
1080867773 11:36210699-36210721 GAAGACAGGATTGCACAGGCAGG + Intronic
1082188290 11:49210318-49210340 GCACCCAGGGGTACACAGCTTGG - Intergenic
1083299421 11:61732567-61732589 GAACCCAGGGTATCACTGGCAGG + Intronic
1083347440 11:62003410-62003432 GAACCCAGGGAACCCCAGGCTGG + Intergenic
1084962050 11:72721933-72721955 GGACCCAGGCTTGCACGGGCAGG - Intronic
1086022225 11:82244754-82244776 GAACCCAAGGTAACATAGACAGG - Intergenic
1087032191 11:93716688-93716710 GAAAGCAGGGATACAGAGGCAGG + Intronic
1087689199 11:101299524-101299546 GTGTTCAGGGTTACACAGGCAGG - Intergenic
1089138281 11:116266713-116266735 GAACCCAAGGTTCCACAGCTGGG - Intergenic
1089590108 11:119534546-119534568 TAACCCAAGGTTACACGGCCAGG - Intergenic
1089730787 11:120517489-120517511 GAAGTCAGGGGTGCACAGGCGGG - Intronic
1091512001 12:1136949-1136971 GAACACAGGTGAACACAGGCAGG - Intronic
1096889988 12:54760137-54760159 AAGACCAGGGTTTCACAGGCTGG + Intergenic
1102470042 12:113154667-113154689 GACCCCAGGCTTCCACAGCCGGG + Intronic
1102877439 12:116459003-116459025 GAACCCAGGGCTCCACAGAAAGG - Intergenic
1102919117 12:116778528-116778550 TAGCCCAGGGTTCTACAGGCTGG - Intronic
1104362213 12:128144566-128144588 GAACCCAGGGCTACCCAGGCAGG + Intergenic
1107718622 13:43225387-43225409 GAATCCAGGGGTACACGTGCAGG - Intronic
1108260147 13:48647835-48647857 GAAGCTAGGGCTACAGAGGCGGG + Intergenic
1108505445 13:51108486-51108508 GAACCCATCATTTCACAGGCAGG + Intergenic
1110624172 13:77633138-77633160 GAAGCCAGGCAAACACAGGCCGG + Intronic
1113632244 13:111896376-111896398 GAAGACAGCGTTACAAAGGCAGG + Intergenic
1117477957 14:56116727-56116749 GAAGCTAGGGTGACAGAGGCAGG + Intergenic
1118980276 14:70710545-70710567 GACCTCAGGGTTACACAAGAAGG + Intergenic
1120154857 14:81082387-81082409 GAAAGCAGGGATACAGAGGCAGG - Intronic
1120388333 14:83873592-83873614 AAAACCAGGGGTCCACAGGCAGG + Intergenic
1122301587 14:100734208-100734230 GAAGCCAGGGGGGCACAGGCAGG - Exonic
1125006207 15:34820768-34820790 TCACCCAGTGTCACACAGGCTGG + Intergenic
1130407322 15:83613482-83613504 GAACCCAGGTTTACACATGGAGG + Intronic
1132940158 16:2502372-2502394 GAAGCCTGGGTCACAGAGGCAGG + Exonic
1139279577 16:65758811-65758833 GTACACAGTGTTACACAGGCTGG - Intergenic
1140229566 16:73106405-73106427 GAACCCAGGATTACACAAGACGG + Intergenic
1141813507 16:86392820-86392842 GACCCCAGGGCCACACAGACAGG + Intergenic
1141813528 16:86392990-86393012 GACCCCAGGGCCACACAGACAGG + Intergenic
1143204789 17:5134069-5134091 GAAGCCAGGGTCACCCAGGAGGG + Intronic
1143441458 17:6977730-6977752 CAACCTATGGTTACCCAGGCTGG - Intronic
1144619164 17:16805244-16805266 CAGCTCAGGTTTACACAGGCTGG + Intergenic
1144893536 17:18510451-18510473 CAGCTCAGGTTTACACAGGCTGG - Intergenic
1145138689 17:20433823-20433845 CAGCTCAGGTTTACACAGGCTGG + Intergenic
1145361130 17:22213435-22213457 GAAATCAGGGATACAGAGGCAGG - Intergenic
1145760487 17:27422739-27422761 GAATCCAGGGTCACCCAGGAGGG + Intergenic
1146160515 17:30557055-30557077 GAAGCCAGGGTCACCCAGGAGGG + Intergenic
1146657200 17:34641613-34641635 GCACCCAGGGTTTCACAAACAGG + Intergenic
1146843881 17:36171760-36171782 GAAGCCAGGGTCACCCAGGAGGG - Intronic
1146856187 17:36259695-36259717 GAAGCCAGGGTCACCCAGGAGGG - Intronic
1146864432 17:36328680-36328702 GAAGCCAGGGTCACCCAGGAGGG + Intronic
1146872094 17:36383606-36383628 GAAGCCAGGGTCACCCAGGAGGG - Intronic
1146879456 17:36434691-36434713 GAAGCCAGGGTCACCCAGGAGGG - Intronic
1146883382 17:36455834-36455856 GAAGCCAGGGTCACCCAGGAGGG - Intergenic
1147056020 17:37835936-37835958 CAGCTCAGGTTTACACAGGCTGG - Intergenic
1147067290 17:37929268-37929290 GAAGCCAGGGTCACCCAGGAGGG + Intronic
1147074980 17:37984230-37984252 GAAGCCAGGGTCACCCAGGAGGG - Intronic
1147078823 17:38008829-38008851 GAAGCCAGGGTCACCCAGGAGGG + Intronic
1147086505 17:38063776-38063798 GAAGCCAGGGTCACCCAGGAGGG - Intronic
1147094760 17:38132764-38132786 GAAGCCAGGGTCACCCAGGAGGG + Intergenic
1147102448 17:38187739-38187761 GAAGCCAGGGTCACCCAGGAGGG - Intergenic
1148115173 17:45171255-45171277 GGACCCAGGGTTCCAGGGGCAGG - Intergenic
1148741895 17:49897763-49897785 GAAGACAGGGTTACAGAGCCTGG + Intergenic
1149847023 17:60014215-60014237 GAAGCCAGGGTCACCCAGGAGGG - Intergenic
1150085379 17:62270822-62270844 GAAGCCAGGGTCACCCAGGAGGG - Intergenic
1150099278 17:62407859-62407881 GAACCCAGAGCTCCACAGGGTGG - Intronic
1150858535 17:68776783-68776805 GAACGCAGGTTTACCCAGGAGGG - Intergenic
1151350803 17:73530977-73530999 GAAACCAGGGTTACAGAGTCAGG - Intronic
1151418567 17:73982755-73982777 GAAACCAGGGTCACAGAGGAGGG - Intergenic
1151885647 17:76921815-76921837 TTACCCAAGGTTACACAGCCAGG - Intronic
1155732672 18:29180417-29180439 GAAAGCAGGGATACAGAGGCAGG + Intergenic
1157459694 18:47878597-47878619 GATCTCACGGTTACCCAGGCTGG - Intronic
1157464613 18:47932049-47932071 GCACCCACTGTGACACAGGCAGG + Intergenic
1159054801 18:63453034-63453056 GAAAGCAGGGATACAGAGGCAGG - Intergenic
1159128474 18:64252927-64252949 AAGCCCAGGGTTACAGTGGCAGG + Intergenic
1161081073 19:2310425-2310447 TCCCCCACGGTTACACAGGCAGG - Intronic
1163027376 19:14520032-14520054 TAACCCAAGGTTACCCAGCCGGG - Intronic
1163367228 19:16882189-16882211 GAAAGCAGGGATACAGAGGCAGG - Intergenic
1166246794 19:41533896-41533918 GAAAGCAGGGATACAGAGGCAGG + Intergenic
1166723245 19:45009675-45009697 GAGCCCAGGGTTTCCCAGGACGG + Intronic
925187895 2:1861762-1861784 AGATCCAGGATTACACAGGCTGG - Intronic
925261732 2:2535163-2535185 GTACCCAGGCTTACCCAGCCTGG - Intergenic
929804563 2:45133240-45133262 GCACCCAGGGGCACACAGCCAGG - Intergenic
935692439 2:105744167-105744189 GCAACCAGGATTCCACAGGCTGG + Intergenic
936371454 2:111905312-111905334 CAGCCCAGGGTTTCACATGCCGG - Intronic
936560370 2:113533267-113533289 GAACCCAGACGTACAGAGGCTGG - Intergenic
938297160 2:130185544-130185566 GCAGCAAGGGTTACACAGGGGGG + Intronic
938459612 2:131489116-131489138 GCAGCAAGGGTTACACAGGGTGG - Intronic
942246046 2:174009650-174009672 AAACCCAGTGTATCACAGGCAGG + Intergenic
944513034 2:200483421-200483443 GTACCCTGGTTTACACAGACAGG - Intergenic
945403658 2:209420693-209420715 GTACCCAAGGTCACACAAGCAGG + Intergenic
946262808 2:218510029-218510051 GTAACCAGGATTACACTGGCTGG - Exonic
946300966 2:218823866-218823888 GGACCCACAGGTACACAGGCTGG - Exonic
948135155 2:235631106-235631128 GATACCAGGGTTACACACTCAGG + Intronic
948194692 2:236086750-236086772 GACCCCAGAGATACACAGGAGGG + Intronic
948832396 2:240604457-240604479 GGCCCCTGGGTGACACAGGCAGG - Intronic
949052861 2:241906447-241906469 GAAAGCAGGGATACAGAGGCAGG + Intergenic
1168968648 20:1915680-1915702 GAGGCCAGGGCTACACAGCCAGG - Intronic
1170320390 20:15090796-15090818 GAACCCAGGAATACAAAGCCTGG + Intronic
1172351855 20:34249247-34249269 GAACCCAGGTTTTTACATGCTGG + Intronic
1172648115 20:36484094-36484116 TAGCCCAGGATTACACAGACAGG - Intronic
1173679110 20:44863912-44863934 GAAAGCAGGGATACAGAGGCAGG - Intergenic
1174879172 20:54258535-54258557 GAACCCAGGTTAACATAGGCGGG - Intergenic
1176008227 20:62877574-62877596 GAGCCCAGGGTGAGACCGGCCGG - Intergenic
1176336019 21:5600982-5601004 GAAAGCAGGGATACAGAGGCAGG - Intergenic
1176391738 21:6219966-6219988 GAAAGCAGGGATACAGAGGCAGG + Intergenic
1176469681 21:7096208-7096230 GAAAGCAGGGATACAGAGGCAGG - Intergenic
1176493242 21:7477986-7478008 GAAAGCAGGGATACAGAGGCAGG - Intergenic
1176507400 21:7660397-7660419 GAAAGCAGGGATACAGAGGCAGG + Intergenic
1176968420 21:15237816-15237838 GAAACTAGGGTAACACTGGCAGG + Intergenic
1178364040 21:31973692-31973714 TTGCCCAGGGTCACACAGGCAGG - Intronic
1180988201 22:19917866-19917888 GAGCCCAGGGCTGCACAGGGAGG - Intronic
1183333931 22:37236074-37236096 TCACCCAGGGTCACACAGCCAGG - Intronic
1184149881 22:42631718-42631740 GAACCCAGGGTCCCAAAGGGAGG + Intronic
1185166248 22:49264155-49264177 AAAGCCAGGGCCACACAGGCCGG - Intergenic
949313397 3:2725279-2725301 GCACCCTGGGTTACAGATGCAGG - Intronic
954107022 3:48414954-48414976 GGACCCAGGGGTCCTCAGGCAGG + Exonic
957089765 3:75718128-75718150 GACCTCAGAGTTACACAGCCAGG + Intronic
959962336 3:112312726-112312748 GAAAGCAGGGATACAGAGGCAGG - Intergenic
962415453 3:135177745-135177767 GAACCCAAGGTAAGACAGGGTGG + Intronic
965850166 3:173013560-173013582 GAAAGCAGGGATACAGAGGCGGG + Intronic
968512813 4:1002936-1002958 GAACCCCGGCTTACCCGGGCCGG - Exonic
969043193 4:4317220-4317242 GAAACCAGGGTTAGTGAGGCAGG - Intronic
969259588 4:6025048-6025070 GAACCAAGGGTTAAAATGGCCGG + Intergenic
969438182 4:7200350-7200372 GAACCCAGGGCTCCCCAGGGAGG - Intronic
969622658 4:8286536-8286558 GCAGCCAGGGAGACACAGGCGGG - Intronic
970942904 4:21656248-21656270 GAACACAGGCTCACACAGGAGGG - Intronic
972171469 4:36350677-36350699 GAACCAAGGGTAACATAGGAGGG + Intergenic
975854904 4:78614026-78614048 AAACACAAGGTTTCACAGGCAGG - Intergenic
976520127 4:86017198-86017220 GAACGCTGGGTTTCGCAGGCAGG + Exonic
982560667 4:156925247-156925269 GAAACCAGGGTAAGAAAGGCTGG + Intronic
982752344 4:159177494-159177516 AAACCCAGGGTCACACAGCTAGG + Intronic
983748013 4:171225506-171225528 GAACCAAGGGTTGCAAAGACAGG - Intergenic
985868607 5:2536334-2536356 TAACTCAGGGTTCCACAGCCTGG + Intergenic
988480529 5:31626653-31626675 GAACCCATGCTTCCAGAGGCTGG - Intergenic
988548761 5:32181616-32181638 TTGCCCAGGGTTACACAGCCTGG + Intergenic
996338848 5:122414102-122414124 GATCTCAGTGTTACTCAGGCTGG + Intronic
996659094 5:125978417-125978439 GAACGCAGCGTTACACAGCCAGG + Intergenic
999400985 5:151264063-151264085 AAAACCAGGGTCCCACAGGCTGG - Intronic
1001953186 5:175830359-175830381 TTGCCCAGGGTTACACAGCCAGG + Intronic
1002693941 5:181071478-181071500 GACCCAAGGGAAACACAGGCTGG + Intergenic
1003114270 6:3273031-3273053 GAGCCCCGGGTTCCGCAGGCCGG + Exonic
1003214004 6:4092248-4092270 GAAAGCAGGGATACAGAGGCAGG - Intronic
1003762980 6:9202384-9202406 GAAGCCAGCCTGACACAGGCTGG - Intergenic
1006888425 6:37401728-37401750 GAAAGCAGGGATACAGAGGCAGG + Intergenic
1017710134 6:157160227-157160249 GCACCTAGCGTCACACAGGCAGG - Intronic
1018330702 6:162724987-162725009 GAAAGCAGGGATACAGAGGCAGG - Intronic
1018350287 6:162951374-162951396 GAGCCCAGATTGACACAGGCAGG + Intronic
1020082555 7:5294683-5294705 GACCCCAAGGGTACACTGGCTGG + Intronic
1020153963 7:5706396-5706418 GAACCCTGGGTGCCAGAGGCTGG - Intronic
1021231988 7:18096255-18096277 GAACACTGGGTAGCACAGGCAGG - Intronic
1021625725 7:22591276-22591298 GAACCTAGAGTTAGACAGACCGG - Intronic
1022142156 7:27501763-27501785 GAATCCAGGGGTACACGTGCAGG + Intergenic
1022674093 7:32482226-32482248 GAAAGCAGGGATACAGAGGCAGG - Intergenic
1023634188 7:42193379-42193401 GAGGCCAGGCTTTCACAGGCAGG - Intronic
1024362760 7:48485979-48486001 GAACCCAGCTGTCCACAGGCAGG - Intronic
1024423643 7:49200246-49200268 GAAAGCAGGGATACAGAGGCAGG - Intergenic
1024511750 7:50209977-50209999 GCACCGAGGGGTCCACAGGCAGG - Intergenic
1025675572 7:63639457-63639479 GACCCCAAGGGCACACAGGCTGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029040268 7:97565905-97565927 GAACCTTGAGTTCCACAGGCAGG + Intergenic
1031972798 7:128076164-128076186 GAACCCAGGGGAGCACAGGGAGG + Intronic
1032403818 7:131641743-131641765 GGAGCCAGGGATACAGAGGCAGG + Intergenic
1032696320 7:134339696-134339718 CAGCCCAAGGTTACACAAGCAGG + Intergenic
1033472854 7:141665060-141665082 GAACCCGGGGTTAGAGAGGTGGG + Intronic
1033472963 7:141665596-141665618 GACACAAGGGTTACAGAGGCCGG - Intronic
1037718368 8:21419143-21419165 GACCCCAGGGTACCCCAGGCGGG + Intergenic
1040292655 8:46133329-46133351 GCACCCAGGGGTTCCCAGGCAGG - Intergenic
1040750810 8:50704570-50704592 AAACCTGGAGTTACACAGGCTGG - Intronic
1041507378 8:58614583-58614605 GAAAGCAGGGATACAGAGGCAGG - Intronic
1043609674 8:82046489-82046511 GCACCCAGTCTTAAACAGGCTGG - Intergenic
1045418741 8:101993189-101993211 GAGCCCAGGGCTACACATTCTGG - Intronic
1045473957 8:102537581-102537603 TTACCCAGGGATGCACAGGCTGG - Intronic
1046929520 8:119828197-119828219 GAACCCAGGGTCACAGAGACAGG - Intronic
1047398856 8:124529068-124529090 GAAAGCAGGGATACAGAGGCAGG - Intronic
1048855890 8:138686331-138686353 CAACCCAGTGTTCCACAGTCAGG - Intronic
1049190458 8:141284741-141284763 GGACCCAGGCAGACACAGGCAGG - Intronic
1049892306 9:82080-82102 GAACCCAGACGTACAGAGGCTGG + Intergenic
1049949116 9:627301-627323 GTACCCAGGGCTACCCAGGTTGG + Intronic
1053733725 9:41083157-41083179 GAACCCAGACGTACAGAGGCTGG + Intergenic
1054694685 9:68348395-68348417 GAACCCAGACGTACAGAGGCTGG - Intronic
1058060760 9:100493252-100493274 GAACTCAGGGTTTCTCAGTCTGG - Intronic
1059387353 9:113974867-113974889 GAGCCCAGGGTCACACAATCAGG - Intronic
1061820572 9:133225371-133225393 GAACCCAGAGGTCCTCAGGCTGG + Intergenic
1062046234 9:134425722-134425744 GAACACAGGGTAAGCCAGGCTGG + Intronic
1203425619 Un_GL000195v1:33920-33942 GAAAGCAGGGATACAGAGGCAGG + Intergenic
1186087196 X:6003262-6003284 GAAAGCAGGGATACAGAGGCAGG + Intronic
1189272104 X:39759104-39759126 CAGCCCAGGGTTACACAGCGTGG - Intergenic
1190367160 X:49706466-49706488 GTACCCATGGCTACACAGTCTGG + Intergenic
1190372846 X:49759466-49759488 GAACTCACAGTTCCACAGGCTGG + Intergenic
1195065236 X:101233738-101233760 CCACCCAGGGTAGCACAGGCAGG + Intronic
1196758315 X:119177410-119177432 GGACCCAGGGTTTCAAGGGCAGG + Intergenic
1197225096 X:123949122-123949144 GAACCCATGGATACAGAGGGAGG - Intergenic
1198223369 X:134623191-134623213 GAACCCAGGGACACTAAGGCTGG + Intronic
1200076197 X:153552412-153552434 GAGCCGAGGGTCACAGAGGCGGG - Intronic
1200916346 Y:8574587-8574609 GAACACGGGGCTACACAGCCCGG - Intergenic
1200933897 Y:8721659-8721681 CAACCCCGGGGAACACAGGCGGG + Intergenic
1202237495 Y:22728821-22728843 GAAAGCAGGGATACAGAGGCAGG - Intergenic