ID: 903056897

View in Genome Browser
Species Human (GRCh38)
Location 1:20642207-20642229
Sequence CCATTGTTATGCAGCAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 139}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903056884_903056897 17 Left 903056884 1:20642167-20642189 CCCAGCACCGTCTAGGCTCTGCC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 903056897 1:20642207-20642229 CCATTGTTATGCAGCAAAGGGGG 0: 1
1: 0
2: 3
3: 6
4: 139
903056881_903056897 28 Left 903056881 1:20642156-20642178 CCTGCTCTCTCCCCAGCACCGTC 0: 1
1: 0
2: 3
3: 64
4: 542
Right 903056897 1:20642207-20642229 CCATTGTTATGCAGCAAAGGGGG 0: 1
1: 0
2: 3
3: 6
4: 139
903056887_903056897 -4 Left 903056887 1:20642188-20642210 CCCCATTCGCTTCCCTCCACCAT 0: 1
1: 0
2: 1
3: 27
4: 299
Right 903056897 1:20642207-20642229 CCATTGTTATGCAGCAAAGGGGG 0: 1
1: 0
2: 3
3: 6
4: 139
903056886_903056897 10 Left 903056886 1:20642174-20642196 CCGTCTAGGCTCTGCCCCATTCG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 903056897 1:20642207-20642229 CCATTGTTATGCAGCAAAGGGGG 0: 1
1: 0
2: 3
3: 6
4: 139
903056888_903056897 -5 Left 903056888 1:20642189-20642211 CCCATTCGCTTCCCTCCACCATT 0: 1
1: 0
2: 0
3: 18
4: 214
Right 903056897 1:20642207-20642229 CCATTGTTATGCAGCAAAGGGGG 0: 1
1: 0
2: 3
3: 6
4: 139
903056880_903056897 29 Left 903056880 1:20642155-20642177 CCCTGCTCTCTCCCCAGCACCGT 0: 1
1: 0
2: 3
3: 55
4: 507
Right 903056897 1:20642207-20642229 CCATTGTTATGCAGCAAAGGGGG 0: 1
1: 0
2: 3
3: 6
4: 139
903056883_903056897 18 Left 903056883 1:20642166-20642188 CCCCAGCACCGTCTAGGCTCTGC 0: 1
1: 0
2: 0
3: 10
4: 149
Right 903056897 1:20642207-20642229 CCATTGTTATGCAGCAAAGGGGG 0: 1
1: 0
2: 3
3: 6
4: 139
903056885_903056897 16 Left 903056885 1:20642168-20642190 CCAGCACCGTCTAGGCTCTGCCC 0: 1
1: 0
2: 1
3: 13
4: 169
Right 903056897 1:20642207-20642229 CCATTGTTATGCAGCAAAGGGGG 0: 1
1: 0
2: 3
3: 6
4: 139
903056889_903056897 -6 Left 903056889 1:20642190-20642212 CCATTCGCTTCCCTCCACCATTG 0: 1
1: 0
2: 0
3: 31
4: 405
Right 903056897 1:20642207-20642229 CCATTGTTATGCAGCAAAGGGGG 0: 1
1: 0
2: 3
3: 6
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903056897 Original CRISPR CCATTGTTATGCAGCAAAGG GGG Intronic
902428938 1:16347180-16347202 CCAGTGTTTTGCTTCAAAGGTGG - Intronic
903056897 1:20642207-20642229 CCATTGTTATGCAGCAAAGGGGG + Intronic
904482224 1:30801257-30801279 CCTTGGTTCTCCAGCAAAGGTGG - Intergenic
904929682 1:34076811-34076833 CCAATGCTATGCAGCTAGGGAGG + Intronic
906581613 1:46939951-46939973 CTATTGTTTCTCAGCAAAGGAGG - Intronic
906602103 1:47138948-47138970 CTATTGTTTCTCAGCAAAGGAGG + Intronic
907094637 1:51766605-51766627 ACAGTGTTATGGAGCAAAAGGGG + Intronic
907684944 1:56601236-56601258 CTTTTTTTATACAGCAAAGGTGG - Intronic
912615907 1:111099659-111099681 CCTCTGGGATGCAGCAAAGGTGG - Intergenic
916911497 1:169352542-169352564 CCACTGTTATTCAACATAGGAGG + Intronic
917084176 1:171289418-171289440 CCAAGGTTGTGCAGCAAAGTAGG - Intergenic
917960356 1:180139076-180139098 CCATTGTATTGCTGCTAAGGAGG - Intergenic
919345655 1:196374004-196374026 GCATTGTTATGCAGGAATGAGGG + Intronic
919421359 1:197374031-197374053 TGATTGTTTTGCAGTAAAGGAGG - Intronic
921001006 1:211042941-211042963 CCTGTGGGATGCAGCAAAGGTGG + Intronic
923246717 1:232139424-232139446 CCACTTTTCTGCAGCACAGGGGG - Intergenic
1063920574 10:10928187-10928209 ACATTGTTCTGGAGCTAAGGGGG - Intergenic
1064461835 10:15542081-15542103 ACACTGTTATGGGGCAAAGGGGG + Intronic
1068601604 10:58963083-58963105 CCATTGGTATAGAGGAAAGGTGG - Intergenic
1069361311 10:67645418-67645440 CCATTGTTATAGAGCAAATAAGG + Intronic
1072922782 10:99590625-99590647 CCATGGTCATCCAGCTAAGGTGG - Intergenic
1073133918 10:101208970-101208992 CAATTGTTATGAGCCAAAGGGGG - Intergenic
1074986279 10:118662673-118662695 CCTGTGTGATGCAGCAGAGGCGG - Intergenic
1077289896 11:1784141-1784163 CGATGGTGATGCGGCAAAGGTGG - Intergenic
1080597522 11:33787484-33787506 CCACTGTTCTCCAGCAAAAGGGG - Intergenic
1086347512 11:85912310-85912332 CTATTGTTTTCCAGGAAAGGTGG + Intronic
1087158402 11:94926318-94926340 TCAGTGTTTAGCAGCAAAGGGGG + Intergenic
1090031502 11:123210426-123210448 CCATCGTTCTGAAGCAAATGAGG + Intergenic
1090061080 11:123464685-123464707 TGATTCTTATGCAGCCAAGGTGG + Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1091975145 12:4818369-4818391 CCCATGTTACCCAGCAAAGGAGG - Intronic
1094808788 12:34117495-34117517 CCTCTGTGATACAGCAAAGGCGG + Intergenic
1100917117 12:99436925-99436947 GCATTCTTTTGCAGCTAAGGAGG - Intronic
1103059196 12:117845199-117845221 TCATTGTTATCGAGCAAAAGGGG - Intronic
1107260198 13:38481374-38481396 CATTTGTTATGCAGCAATAGAGG + Intergenic
1111147430 13:84202603-84202625 CCATTGTTTTGCCGCAAAGGAGG - Intergenic
1112910187 13:104472901-104472923 CCATTGTTCTCCAGCAATGAAGG + Intergenic
1115929981 14:38480237-38480259 CCATTCTTATGCAGCCAAATAGG + Intergenic
1116265890 14:42689100-42689122 CCATTGTTATACATTCAAGGAGG + Intergenic
1117966933 14:61215998-61216020 CAATTTTTATGCTGCAAAGTTGG - Intronic
1118139905 14:63069475-63069497 CCTCTGGTATACAGCAAAGGTGG - Intronic
1119845490 14:77826499-77826521 CCTTTGCTAGGCAGCCAAGGTGG + Intronic
1120043917 14:79785270-79785292 TGTTTGTTAAGCAGCAAAGGTGG + Intronic
1121450067 14:94001383-94001405 CCAGGGCTATGCAGGAAAGGGGG - Intergenic
1121570702 14:94944621-94944643 ACATTTGTATGCAGGAAAGGAGG - Intergenic
1125009264 15:34852686-34852708 GCATTGTGATTCTGCAAAGGAGG + Exonic
1125184841 15:36918640-36918662 CCATGGGTGTGCAGAAAAGGTGG + Intronic
1130247703 15:82267635-82267657 TCATTCTTATATAGCAAAGGTGG + Intronic
1130606158 15:85318919-85318941 CCAAAGTTATGCAGCAGATGGGG - Intergenic
1131624204 15:94100672-94100694 CCATTCTTATGTGGCCAAGGAGG - Intergenic
1132036774 15:98491649-98491671 CTATTGTTATAAAGCAAAGTAGG + Intronic
1134765566 16:16754641-16754663 CCAATGTCATGCAGCTAATGTGG - Intergenic
1134980484 16:18604572-18604594 CCAATGTCATGCAGCTAATGTGG + Intergenic
1135863611 16:26080247-26080269 CCATTTTCTAGCAGCAAAGGAGG - Intronic
1143281813 17:5760132-5760154 CCTTTGTTACCAAGCAAAGGGGG - Intergenic
1145051285 17:19663554-19663576 GCATTGTTTTACAGCAAAGAAGG - Intronic
1146583649 17:34062354-34062376 CCTTTGGGATGCAGCAAAAGTGG + Intronic
1149495494 17:57114758-57114780 CCATTGTTATGGAGCTGGGGTGG + Intronic
1158018818 18:52816233-52816255 CCATTGTCATGCAGGAAAAAGGG + Intronic
1159084017 18:63767090-63767112 CCATGGTTATCCAGCAAGAGTGG - Intronic
1163078898 19:14921436-14921458 CAAATGTTAAACAGCAAAGGTGG - Intergenic
1164908421 19:31986075-31986097 TCATTTTTATGTAGCAATGGGGG - Intergenic
1165169456 19:33881235-33881257 CCATTGTATTGCAACAAACGTGG + Intergenic
925306548 2:2851088-2851110 CCATCATTATGCAGCATAGGGGG + Intergenic
925583003 2:5433035-5433057 TCATTGCTCTGTAGCAAAGGGGG + Intergenic
928772264 2:34717113-34717135 CCTCTGGGATGCAGCAAAGGCGG - Intergenic
931169355 2:59786479-59786501 CCACTGTTACACAGTAAAGGGGG + Intergenic
931951581 2:67369334-67369356 CCAATGGGATGCAGCAAAGGTGG + Intergenic
932633630 2:73368902-73368924 CAATTGTTATGTAACAGAGGTGG - Intergenic
932795269 2:74689666-74689688 ACATTGTTAAGCAAAAAAGGAGG + Intergenic
936899486 2:117467658-117467680 CCATTATGATGCAGTAAAGATGG - Intergenic
938577584 2:132619040-132619062 CCAGAGTTATGGAGCAGAGGTGG - Intronic
938975043 2:136468920-136468942 CCAGTGTTCTCCAGCAAAGATGG - Intergenic
940240247 2:151554644-151554666 ACATTGTTATGCAACACATGAGG - Intronic
942532257 2:176923705-176923727 CCATTGTCCAGCAGTAAAGGTGG + Intergenic
942745205 2:179224363-179224385 CCAACGTTATGCAGCAAAACTGG + Intronic
1170124589 20:12949362-12949384 ACAGTGTTATGGAGCAAAAGGGG - Intergenic
1174325072 20:49772429-49772451 CCATTGTTCTGCATGAGAGGGGG - Intergenic
1174880664 20:54275857-54275879 CCATGGTTATACAACAAAAGTGG - Intergenic
1176989609 21:15479583-15479605 CCATTGGCATGCAGCATAGAAGG - Intergenic
1177118567 21:17114255-17114277 CAACTGTGATGCATCAAAGGAGG + Intergenic
1178726186 21:35053684-35053706 CCTTTCTTTTGCAGCAAAGGAGG - Intronic
1181732394 22:24856684-24856706 CCATTGTGATGCAGATACGGAGG - Intronic
1182819696 22:33204725-33204747 CCATTTTCACACAGCAAAGGTGG + Intronic
951035380 3:17926904-17926926 ACACTATTATGCAGCCAAGGTGG - Intronic
952468906 3:33623333-33623355 CCAGTGTTAGGCAGCACAGTAGG - Intronic
953261110 3:41339693-41339715 CCACTCTTATACAGTAAAGGTGG + Intronic
954807060 3:53226747-53226769 CCATTATTATGAAGGTAAGGAGG - Exonic
955871525 3:63443320-63443342 CTCTTTTTATGAAGCAAAGGAGG - Intronic
956387797 3:68739174-68739196 CCATTGTGATTCAGAAATGGTGG - Exonic
960403630 3:117233443-117233465 CCATCATTATGCAGCACATGTGG + Intergenic
961085233 3:124061482-124061504 CCATTGTTATGAACAAAAGCTGG - Intergenic
962920915 3:139949688-139949710 CCAATGCTATGGAGCAAAGTGGG - Intronic
963347273 3:144110048-144110070 CCATTCTTATGCAGCCAAGAGGG + Intergenic
964640994 3:158910557-158910579 CCATTGTGATGCAGGACAGGTGG + Intergenic
964670840 3:159224370-159224392 TCTTTGTTATCCTGCAAAGGTGG - Intronic
967912872 3:194556474-194556496 CCATTGCTAGGGAGCACAGGAGG - Intergenic
968722925 4:2221038-2221060 CCATTGTTCTCCAGCAAAGGTGG + Intronic
971612526 4:28743857-28743879 CCATGGTTATCCATCAAATGCGG + Intergenic
972750845 4:41987242-41987264 CCATTGTTGTACAGGAGAGGGGG + Intergenic
972901826 4:43694886-43694908 CCATTGTGATGCAGCAAAAGTGG - Intergenic
976408062 4:84681717-84681739 CCACTGTTCTACATCAAAGGGGG + Intronic
976791491 4:88883492-88883514 CCTCTGTAATACAGCAAAGGTGG + Intronic
979135287 4:117103732-117103754 CAATTTTTATGCAGAAAAGAGGG - Intergenic
980561809 4:134487106-134487128 TCCTTGTTATGAAGCAAAGAAGG - Intergenic
981466686 4:145080449-145080471 CCACTGTTATGGCACAAAGGTGG - Intronic
985093156 4:186384414-186384436 CCTTTGGCATACAGCAAAGGTGG + Intergenic
986070166 5:4275048-4275070 CCAGTGTTATGTTGCACAGGTGG + Intergenic
991548969 5:67815817-67815839 CCATTTCTGTGCAGCAAAAGGGG - Intergenic
992833365 5:80616911-80616933 CCATTTTTATACAGAAATGGGGG + Intergenic
995153185 5:108876157-108876179 CCATTTTTATGCAGCCCACGAGG + Intronic
995327075 5:110902819-110902841 CCATGGTGTTGCAGCAGAGGGGG + Intergenic
999230240 5:150057459-150057481 CCCTTGTTATCAAGCAAATGGGG + Intronic
1000621979 5:163496112-163496134 CCCTTGGTATGCAGCAACTGTGG + Intergenic
1003206294 6:4015561-4015583 CCATTGTACTCCAGCCAAGGAGG + Intergenic
1004494847 6:16153992-16154014 CCTTTGTCCTGCAGCAAGGGAGG - Intergenic
1005072754 6:21877173-21877195 CCTCTGTGATACAGCAAAGGCGG + Intergenic
1007697243 6:43741457-43741479 CCTTTTTTATGCAGCATAGAAGG - Intergenic
1008443484 6:51559947-51559969 CCATTCTGATGCAGCAAAAATGG - Intergenic
1020234816 7:6347536-6347558 CCAATTTTTTACAGCAAAGGCGG + Intronic
1022818384 7:33935175-33935197 CCATTATCATGGAGAAAAGGGGG + Intronic
1024112420 7:46160886-46160908 CCATTTTCAGACAGCAAAGGAGG - Intergenic
1030160473 7:106503246-106503268 CCATGGTTATACTCCAAAGGGGG + Intergenic
1031488186 7:122355211-122355233 GCATTCCTATGCAGAAAAGGAGG - Intronic
1036287185 8:7453390-7453412 CAATTGTTATGAAGCCCAGGGGG - Intronic
1036334296 8:7858133-7858155 CAATTGTTATGAAGCCCAGGGGG + Intronic
1037344680 8:17886237-17886259 CCATTGTTTTCCAGTAAAAGAGG - Intronic
1037671413 8:21018360-21018382 CCAGTGTTAAAGAGCAAAGGGGG - Intergenic
1039083043 8:33752820-33752842 CCTCTGTGATACAGCAAAGGTGG - Intergenic
1039840769 8:41291473-41291495 CATTTGTCAGGCAGCAAAGGTGG - Intronic
1041826512 8:62101126-62101148 CCATTATGATGCAACAAAGGTGG - Intergenic
1044757021 8:95474071-95474093 CTAGTGTTGGGCAGCAAAGGAGG + Intergenic
1050559801 9:6823298-6823320 CCAATGTTTTGCACCAAAAGGGG + Intronic
1051601118 9:18875413-18875435 CCTCTGTGATACAGCAAAGGTGG - Intronic
1052837388 9:33261913-33261935 CCATTGTTCTGACTCAAAGGAGG - Intronic
1054824686 9:69561416-69561438 CCATTGTTATGTAGGAAGGAAGG + Intronic
1055700321 9:78938084-78938106 CCTTTGGTATGTGGCAAAGGTGG - Intergenic
1056534998 9:87519377-87519399 CCATTGGGTTGCAGCGAAGGGGG - Intronic
1057848766 9:98548004-98548026 CCAATCATATGCAGCAAAGCAGG - Intronic
1058151002 9:101463658-101463680 CCATTGTTACTGAGCAAAAGAGG + Intergenic
1061756350 9:132815152-132815174 CCCTTGTTACACAGCAGAGGGGG + Intronic
1186185128 X:7013437-7013459 CTATGATTCTGCAGCAAAGGTGG + Intergenic
1189186137 X:39057076-39057098 TCATTGTTATTCAGCAAATACGG - Intergenic
1193980834 X:88180396-88180418 CCATTGTATTGCAGCAGAGCTGG + Intergenic
1194955810 X:100179054-100179076 CCTCTGGTATACAGCAAAGGCGG + Intergenic
1195564053 X:106321932-106321954 TCATTCTTATGCAGCCAAGTGGG - Intergenic
1195795761 X:108645052-108645074 CCTTTGGGATACAGCAAAGGTGG + Intronic
1196097621 X:111816791-111816813 CCATTGTTATGGAAGGAAGGTGG + Intronic
1196675501 X:118416345-118416367 CCTTTGGGATACAGCAAAGGTGG - Intronic