ID: 903057271 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:20644970-20644992 |
Sequence | CAGAGGGTGAGGAAGGAGAA CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 94603 | |||
Summary | {0: 1, 1: 9, 2: 723, 3: 6013, 4: 87857} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
903057271_903057277 | 2 | Left | 903057271 | 1:20644970-20644992 | CCGTTCTCCTTCCTCACCCTCTG | 0: 1 1: 9 2: 723 3: 6013 4: 87857 |
||
Right | 903057277 | 1:20644995-20645017 | TCCCCTAACTTTGCTATAGTGGG | 0: 1 1: 0 2: 0 3: 6 4: 74 |
||||
903057271_903057276 | 1 | Left | 903057271 | 1:20644970-20644992 | CCGTTCTCCTTCCTCACCCTCTG | 0: 1 1: 9 2: 723 3: 6013 4: 87857 |
||
Right | 903057276 | 1:20644994-20645016 | ATCCCCTAACTTTGCTATAGTGG | 0: 1 1: 0 2: 3 3: 11 4: 158 |
||||
903057271_903057281 | 17 | Left | 903057271 | 1:20644970-20644992 | CCGTTCTCCTTCCTCACCCTCTG | 0: 1 1: 9 2: 723 3: 6013 4: 87857 |
||
Right | 903057281 | 1:20645010-20645032 | ATAGTGGGTATTTTATTTTAAGG | 0: 1 1: 0 2: 1 3: 50 4: 420 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
903057271 | Original CRISPR | CAGAGGGTGAGGAAGGAGAA CGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |