ID: 903057271

View in Genome Browser
Species Human (GRCh38)
Location 1:20644970-20644992
Sequence CAGAGGGTGAGGAAGGAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94603
Summary {0: 1, 1: 9, 2: 723, 3: 6013, 4: 87857}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903057271_903057277 2 Left 903057271 1:20644970-20644992 CCGTTCTCCTTCCTCACCCTCTG 0: 1
1: 9
2: 723
3: 6013
4: 87857
Right 903057277 1:20644995-20645017 TCCCCTAACTTTGCTATAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 74
903057271_903057276 1 Left 903057271 1:20644970-20644992 CCGTTCTCCTTCCTCACCCTCTG 0: 1
1: 9
2: 723
3: 6013
4: 87857
Right 903057276 1:20644994-20645016 ATCCCCTAACTTTGCTATAGTGG 0: 1
1: 0
2: 3
3: 11
4: 158
903057271_903057281 17 Left 903057271 1:20644970-20644992 CCGTTCTCCTTCCTCACCCTCTG 0: 1
1: 9
2: 723
3: 6013
4: 87857
Right 903057281 1:20645010-20645032 ATAGTGGGTATTTTATTTTAAGG 0: 1
1: 0
2: 1
3: 50
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903057271 Original CRISPR CAGAGGGTGAGGAAGGAGAA CGG (reversed) Intronic
Too many off-targets to display for this crispr