ID: 903058427

View in Genome Browser
Species Human (GRCh38)
Location 1:20652991-20653013
Sequence TAGCCAGGGCTGGCCATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903058422_903058427 -3 Left 903058422 1:20652971-20652993 CCTGAGATAAAAGGCCAGGTTAG 0: 1
1: 0
2: 2
3: 9
4: 143
Right 903058427 1:20652991-20653013 TAGCCAGGGCTGGCCATGACTGG 0: 1
1: 0
2: 0
3: 15
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903058427 Original CRISPR TAGCCAGGGCTGGCCATGAC TGG Intronic
900299412 1:1969442-1969464 TGGGCAGGGCTGGGCAGGACTGG - Intronic
901538738 1:9900950-9900972 TAGCCAGAGCTGACCTTGGCAGG + Intronic
902101508 1:13994097-13994119 TAGCCAGGGAACTCCATGACAGG + Intergenic
903058427 1:20652991-20653013 TAGCCAGGGCTGGCCATGACTGG + Intronic
903380764 1:22895594-22895616 CAGCCAGGCCTGGCCAAGCCTGG - Intronic
904808985 1:33151202-33151224 TCGCCAGGGCTGGCATTCACTGG - Intronic
905403228 1:37717667-37717689 TGGCCAGGCCGGGCCATGAGAGG - Exonic
907459962 1:54599605-54599627 CAGCCAGGGGTGGGCAGGACTGG - Intronic
910471818 1:87561507-87561529 TAGCCAGTGCAGGCCATGAGTGG - Intergenic
911802260 1:102157208-102157230 CAGTCAGGGCTGGTCATGGCTGG - Intergenic
914398185 1:147290621-147290643 GAGCCAGGGAAGGCCATGAAGGG - Intronic
914947782 1:152081183-152081205 GAGACAGGGCCGGCCAAGACAGG - Intergenic
918190999 1:182174450-182174472 GAGCCAGGGCTGGCTGTGTCAGG + Intergenic
918616607 1:186551210-186551232 TAGCCAAGGGAAGCCATGACAGG - Intergenic
920055017 1:203185158-203185180 GGGCCAGGGCTGGCCAGGAGAGG - Intronic
920577617 1:207073042-207073064 TAGTCTGGGCTGGCCCTTACAGG - Exonic
921440587 1:215181870-215181892 TAGGCAGGGCTGGGCTTGGCAGG + Intronic
924422815 1:243925112-243925134 CAGCCAAGGCTGGCCTTGCCGGG - Intergenic
924932732 1:248745191-248745213 TTTCCAGGGCTTCCCATGACAGG + Exonic
1066500265 10:35986705-35986727 TGCCCAGAGCTGTCCATGACTGG - Intergenic
1067407814 10:46038934-46038956 AAGCCAGTGCTGGCCAAGAGGGG - Intronic
1069719291 10:70539488-70539510 GGGCCAGGCCTGGCCATGGCAGG + Intronic
1074271798 10:111961286-111961308 TAGCCAGAGATTGCCATAACTGG - Intergenic
1075356182 10:121778901-121778923 TAGCAAAAGCTGGCCATGGCTGG - Intronic
1075767248 10:124903365-124903387 TAGCCCTGACTGGCAATGACAGG - Intergenic
1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG + Intergenic
1079004747 11:16783686-16783708 AAGCGAGGGCTGACCTTGACCGG + Intronic
1080642493 11:34165964-34165986 TAGCAAGGGCGGGCTTTGACAGG + Intronic
1081324628 11:41729192-41729214 TAGCCAAGGGAAGCCATGACAGG - Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1085297651 11:75439990-75440012 CAGTCTGGACTGGCCATGACTGG - Intronic
1085535650 11:77215694-77215716 CAACCAGGTTTGGCCATGACTGG + Intergenic
1085800685 11:79586312-79586334 TAGCCAAGGGAAGCCATGACAGG + Intergenic
1088686796 11:112290386-112290408 TAACCAGGGCGTGCCATGCCCGG - Intergenic
1090245697 11:125214562-125214584 TTGCCTGGGCTGGCCCTGCCTGG + Intronic
1090748155 11:129723562-129723584 CAGCCAGGGCTGGCCTGGTCGGG + Intergenic
1091818076 12:3454513-3454535 CCTCCAGGGCTGGGCATGACGGG - Intronic
1098668979 12:73200398-73200420 TAGCCATGGCTGGCCATAGCGGG - Intergenic
1104636399 12:130440262-130440284 TGGCCAGGGTTAGCCATGCCCGG - Intronic
1105337400 13:19486728-19486750 TTGCCAGGGCTGGCCAAGAGGGG + Intronic
1107602302 13:42025921-42025943 CGGGCAGGGCTGGCCATGGCAGG + Intergenic
1108632674 13:52302131-52302153 TTGCCAGGGCTGGCCAAGAGGGG + Intergenic
1108654025 13:52510462-52510484 TTGCCAGGGCTGGCCAAGAGGGG - Intergenic
1110626981 13:77663001-77663023 GGGACAGGGCTGGCCAAGACAGG - Intergenic
1110915499 13:81015987-81016009 TAGGCAGGGCTGGCCTAGGCAGG + Intergenic
1113825885 13:113252717-113252739 AGGCCAGGGCTGGGCATGGCCGG + Intronic
1114570115 14:23660919-23660941 TAGCCAGGACGCGCCATCACAGG - Intergenic
1115768627 14:36647840-36647862 TGGCGAGGGCTGGCGAGGACTGG + Intergenic
1117856800 14:60042643-60042665 TAGCCAAGGGAAGCCATGACAGG - Intronic
1118817259 14:69322334-69322356 TGGCTAGGGCTGCCCATGAAAGG - Intronic
1118820347 14:69341534-69341556 TGGCCAGGGCTGGACATGGCAGG + Intronic
1120661134 14:87252488-87252510 GAGCCAGGGAAGGCCATGAAAGG - Intergenic
1121253766 14:92517109-92517131 TTGCCATGTCTTGCCATGACAGG - Intronic
1129760976 15:78129207-78129229 CAGCCCGGGCTGGCAATGGCTGG + Intronic
1129968925 15:79760238-79760260 TAGGCAAGGCTGGCCAGGCCTGG - Intergenic
1130834727 15:87638753-87638775 TAGCCAGGGCTGGCCAGGCTGGG + Intergenic
1132364239 15:101245022-101245044 TAGCTAGAGCTGGACAGGACCGG - Intronic
1132380554 15:101363017-101363039 GAGCCAGTGATGGCCATGGCAGG + Intronic
1132551698 16:556345-556367 TGGGCAGGGGTGGCCATGGCAGG + Intergenic
1132708453 16:1256329-1256351 TAGGCCGGGCTCGCCAGGACGGG - Exonic
1132827761 16:1913616-1913638 GAGTCAGGGCTGGGCGTGACTGG - Intronic
1132939392 16:2499437-2499459 GAGCCAGGGCTGGCTCTGATGGG + Intronic
1135460960 16:22642563-22642585 CAGCCAGGGCCTGCCATGTCGGG + Intergenic
1135847289 16:25930315-25930337 TAGACAGGGCTGGCCTAGAGAGG - Intronic
1136011044 16:27363561-27363583 CAGCAAGGACTGGCCATGACAGG - Exonic
1137387704 16:48056620-48056642 AAGTAAGGGCAGGCCATGACTGG - Intergenic
1138270694 16:55693867-55693889 TTGCCAGGGCTGCCCATCTCTGG + Intronic
1139674222 16:68511812-68511834 TAGCCAGGCCTGGTCATGCGCGG + Intergenic
1140403587 16:74692178-74692200 AAGCCTGGGCTAGCCATGAATGG + Intronic
1141070987 16:80954512-80954534 CAGCCAGGGATGGCCATCCCTGG + Intergenic
1141070988 16:80954515-80954537 CAGCCAGGGATGGCCATCCCTGG - Intergenic
1141685780 16:85569134-85569156 TAGGCAGGGTTGGCCCTGTCGGG - Intergenic
1142124990 16:88405765-88405787 TTGGCAGGGCGGGCTATGACCGG - Intergenic
1142849330 17:2696669-2696691 GAGCCCGGGCTGGCCCTGCCAGG - Intronic
1148096318 17:45054786-45054808 TAATCATGGCTGGCCAAGACAGG + Intronic
1151668796 17:75560167-75560189 TGCCCAGGGCAGGGCATGACTGG + Intronic
1152084551 17:78210027-78210049 TAGCCAGGAAAGGCCATGCCCGG - Intergenic
1152089479 17:78238865-78238887 CAGGCAGGGCTAACCATGACAGG + Intronic
1152235332 17:79135547-79135569 AGGCCTGGGCTGCCCATGACTGG + Intronic
1152466481 17:80469596-80469618 GAGCCAGGCCTGGCCAGGGCAGG - Exonic
1152754272 17:82080641-82080663 TGGTCAGTGCTGGCCATCACGGG - Intronic
1154176256 18:12088460-12088482 TGGCCAGGGCAGGGCAGGACCGG - Intergenic
1156443876 18:37219728-37219750 TAGCCAAGGGAAGCCATGACAGG - Intronic
1157342576 18:46792317-46792339 CAGCCAGGGCTGGGAATCACTGG + Intergenic
1157490190 18:48117862-48117884 TAGCCAGGGCTGGCAAGTAAAGG - Intronic
1160309266 18:77773452-77773474 TAGCCAGACCAGGCCAGGACCGG + Intergenic
1160309332 18:77774474-77774496 TAGCCAGACCAGGCCAGGACGGG - Intergenic
1162416627 19:10542241-10542263 TAGCCAGGGGTGGCCAGGCACGG + Intergenic
1163862202 19:19748363-19748385 TGGCCAGGGATGGCCAGGCCTGG + Intergenic
1164914802 19:32043977-32043999 TAGCCAGGACTGGGCAATACAGG - Intergenic
1165086036 19:33348038-33348060 TAGGCAGTGATGGCCATGGCGGG + Intergenic
1167596325 19:50430183-50430205 TAGCCAGGGATGGCAGCGACTGG - Exonic
925149350 2:1603773-1603795 TAAGCAGGGATGGCCGTGACAGG + Intergenic
925499978 2:4491569-4491591 CAGAGAGAGCTGGCCATGACAGG + Intergenic
926724421 2:15986460-15986482 TTCCCAGGGCTGGCCCTGACAGG - Intergenic
927385186 2:22524425-22524447 CAGCCAGGCCTGGCCTTGTCTGG + Intergenic
933087592 2:78075599-78075621 TACACAGGGCTGGCCAGGAGTGG + Intergenic
936966298 2:118130470-118130492 CAGCCAAGGCTGGCCTAGACTGG + Intergenic
937135331 2:119546742-119546764 TAGCCAGAGCTGGAAATGAGTGG - Intronic
938132421 2:128728190-128728212 GAGCCAGGGAAGGCCATGAAGGG - Intergenic
938171164 2:129078163-129078185 TAGCCTGAGCTGACTATGACCGG - Intergenic
938964430 2:136375785-136375807 TATGCAGGGCTGGGCATGCCTGG - Intergenic
939070412 2:137533720-137533742 TAGCCTGGGCTGCCACTGACAGG + Intronic
940359676 2:152783713-152783735 TAGCCAGTGATGACCATGGCAGG + Intergenic
946111508 2:217422106-217422128 AAGACAGGGCAGACCATGACAGG - Intronic
946181815 2:217953564-217953586 CAGCCAGGGCAGGCTATGATTGG - Intronic
946829890 2:223717820-223717842 GAGCCAGGGAAGGCCATGAAGGG - Intergenic
947473410 2:230418522-230418544 TAGCCAGGCTTGGCCAGGGCAGG + Intronic
1170762043 20:19259559-19259581 CCTCCAGGGGTGGCCATGACTGG - Intronic
1172081420 20:32344030-32344052 TAGCCTGGGCTGGCCAGGCGTGG + Intergenic
1173332155 20:42084579-42084601 TAGCCAGGCCTGCCTAGGACTGG + Intronic
1175637529 20:60598334-60598356 TGGGTAGGGCTGACCATGACTGG + Intergenic
1175976927 20:62715529-62715551 TGGCCATGGCTGGCTCTGACTGG + Intronic
1176736167 21:10548647-10548669 TTGCCAGGGCTGGCCAAGAGGGG - Intronic
1178467891 21:32865298-32865320 TGGGCAGGGCTGGAAATGACAGG + Intergenic
1180208768 21:46280557-46280579 TAGCCAGGGCTGCAGATGCCTGG + Exonic
1180955050 22:19737810-19737832 TAGCCAGGGGAGCCCATGATGGG - Intergenic
1180980639 22:19876557-19876579 TGGGCAGGGCCGGCCATCACAGG + Intronic
1181045159 22:20210867-20210889 TGGCCAGGGCTGTGCATGGCAGG + Intergenic
1182356053 22:29722659-29722681 ATGCCAGGGCTGGCCATTCCTGG + Intronic
1182575236 22:31268464-31268486 TGGCCTGGGCTTGCCATCACAGG + Intronic
1183532976 22:38374208-38374230 TTGCCAGGGCTGGCCAAGAAGGG + Intronic
1184309400 22:43631495-43631517 AAGCCTGGGCTGGCCAGGAAAGG - Intronic
1185204781 22:49531632-49531654 CAGCCAGGGCTGCCCCTGCCTGG - Intronic
1185324530 22:50219227-50219249 GAGTCAGGGCGGGCCAGGACGGG + Intronic
954780493 3:53055716-53055738 TAGCCAGGCGTGGTAATGACAGG - Intronic
957724113 3:84042491-84042513 TAGCCAAGGCTGTCTGTGACTGG + Intergenic
958427879 3:94000319-94000341 CAGCAAGGGGTGGCCATGAGGGG - Intronic
964896483 3:161602728-161602750 GAGCCAGGGAAGGCCATGAAGGG - Intergenic
968515766 4:1015050-1015072 AAGCCAGGGCTGGGCAAGCCAGG - Intronic
968515771 4:1015065-1015087 GAGCCAGGGCTGGGCAAGCCAGG - Intronic
968588751 4:1447113-1447135 TAACCAGGGCAGGGCCTGACGGG + Intergenic
968938644 4:3626502-3626524 GAGGCAGGGCTGGCCTGGACAGG - Intergenic
969242463 4:5909154-5909176 TAGGCAGGGCTAGATATGACAGG - Intronic
969583782 4:8080458-8080480 AAGCCAGGGCTGGCCAGGGAAGG + Intronic
969895761 4:10302998-10303020 TGGGCTGGGCTCGCCATGACTGG - Intergenic
974938489 4:68436174-68436196 GGGCCAGGCCTGGCCAGGACTGG - Intergenic
975080141 4:70267857-70267879 TAGCCAGGCCTGGCCAAGCGCGG + Intergenic
980929153 4:139168955-139168977 GAGCCAGGGAAGGCCATGAAAGG + Intronic
981315275 4:143335723-143335745 GACCCAGGGCTGGCCAGGGCTGG - Intergenic
982619385 4:157684407-157684429 TAGCCAGGACTCATCATGACTGG + Intergenic
984434055 4:179685576-179685598 TAGCCAAGGGAAGCCATGACAGG - Intergenic
985209061 4:187572545-187572567 TAGCCAGGGCTGCCCTTCAGTGG - Intergenic
986233055 5:5884695-5884717 TATCCATGGCTGGCCTTGGCAGG + Intergenic
986684477 5:10264124-10264146 TAGCCAGGCCTGGTCAGGGCAGG + Intronic
990949078 5:61278512-61278534 TAGCTAGTGCTGCCCATGCCGGG - Intergenic
991502334 5:67289547-67289569 TGGGCAGAGCTGTCCATGACAGG - Intergenic
992447939 5:76850671-76850693 TGGCCAGTGCTGGGCATGCCTGG + Intronic
994466263 5:100136670-100136692 TAGCAAGTGCTGGCAATGATTGG - Intergenic
995726478 5:115186216-115186238 TAGCCTGGGCTGGCCATCCTAGG - Intergenic
995898806 5:117045978-117046000 TATCAAGGGCTAGCCATCACGGG + Intergenic
997343919 5:133171126-133171148 TAGCCAAGGGAAGCCATGACAGG - Intergenic
997885769 5:137628507-137628529 TGGTCAGGGCTGTCCAGGACTGG - Intronic
998353609 5:141516614-141516636 CAGCCAGGGCTGGCTAAGTCGGG + Exonic
999601437 5:153270645-153270667 TAGCCCGGGCTGGCCAGGAAGGG + Intergenic
1000042170 5:157492995-157493017 GACCCAGGGCTGGTGATGACTGG - Exonic
1002026749 5:176400970-176400992 AGGCCAGGGCAGGCCAGGACAGG + Intronic
1002088840 5:176792814-176792836 TGGCCAGGCCTGGGGATGACAGG + Intergenic
1006406398 6:33848252-33848274 TAGGCAGGGCTGGCCAGGGCAGG - Intergenic
1006723899 6:36181947-36181969 TAACCAGGGCTGGGCATGGTGGG + Intergenic
1007391347 6:41551293-41551315 TCGCCCGGGCTGGACATGCCTGG + Intronic
1007970344 6:46045888-46045910 TAGCCAGTGCTTCCAATGACTGG - Intronic
1009690889 6:67031024-67031046 TCTCTAGGGCTGGCCAAGACCGG + Intergenic
1012129367 6:95471648-95471670 TAGCCAAGGGAAGCCATGACAGG + Intergenic
1015419142 6:132986370-132986392 TAGCCAAGGGAAGCCATGACAGG - Intergenic
1016840067 6:148516945-148516967 TGGCCAGGGTTGTCCCTGACAGG - Intronic
1020480007 7:8647338-8647360 CTGCCAGGGCTGGGCATGAGTGG - Intronic
1022801324 7:33780071-33780093 TAGCCTGGCCAGGCCATGCCCGG - Intergenic
1025004177 7:55342578-55342600 TGAGCAGGGCTGGCCATGGCGGG - Intergenic
1026892141 7:73988490-73988512 TGGGCAGGGCTGGCCTTGTCTGG - Intergenic
1032173719 7:129607323-129607345 TAGAGATGGCTGGCCAAGACAGG - Intergenic
1032855807 7:135832652-135832674 GAGCCAGGGCTGACCAAGGCAGG - Intergenic
1032865407 7:135919537-135919559 TAGCAAGGGCAGGCCATTCCCGG + Intergenic
1034338712 7:150339153-150339175 GAGCCAGGGCTGCCCATCATGGG + Intronic
1035252535 7:157606446-157606468 CAGCCAGGGATGGCAGTGACAGG - Intronic
1035657468 8:1320723-1320745 TGGAGAGGTCTGGCCATGACTGG - Intergenic
1037471728 8:19216959-19216981 GAGACAGGGCAGGCCATGCCAGG - Intergenic
1038540135 8:28385223-28385245 TGGCCAGGGCTGCCCAAAACCGG + Intronic
1039226872 8:35397935-35397957 TAGACAGGGCTGGACAGGTCAGG - Intronic
1042918867 8:73901998-73902020 GAGCCAGGGAAGGCCATGAAGGG - Intergenic
1048557904 8:135498901-135498923 TACCCAGTTCTGTCCATGACAGG - Intronic
1049400514 8:142424702-142424724 GAGGCAGGGCAGGCCAGGACAGG - Intergenic
1050026046 9:1335425-1335447 TAGCTATGGCTGTCCATGACAGG + Intergenic
1050454394 9:5819335-5819357 GAGCCAGGGAAGGCCATGAAGGG + Intronic
1052165471 9:25321088-25321110 TAGCAAGGACTGGCCAAGATTGG - Intergenic
1052833955 9:33236521-33236543 GAGCCGGGGAGGGCCATGACAGG - Intronic
1054950394 9:70844554-70844576 TGTCCAGGGCTGGCCCTGAAAGG - Intronic
1055229363 9:74043030-74043052 GAGCCAGGGACGGCCATGAAGGG + Intergenic
1057014237 9:91636511-91636533 TGGGCAGGGCAGGGCATGACAGG + Intronic
1057228268 9:93303916-93303938 GAGCCAGTGCTGACCATGGCGGG + Intronic
1057893592 9:98888480-98888502 CAGCCAGGGCTGGTCATTAGAGG + Intergenic
1061775975 9:132964507-132964529 GAGCCGGGGAAGGCCATGACGGG + Intronic
1061922470 9:133789560-133789582 TTGGCAGGGCTGGCCAGGAAAGG - Intronic
1186521313 X:10209180-10209202 TGGGTAGGGCTGGGCATGACAGG + Intronic
1189719829 X:43904928-43904950 TAGCCAGGGATGGCCATTCTGGG + Intergenic
1190249282 X:48709872-48709894 TAGTTTGGACTGGCCATGACTGG + Intergenic
1192810949 X:74546940-74546962 TGGCCAAGGCTGGTCATGGCTGG - Intergenic
1192810976 X:74547169-74547191 TAGTCAAAGCTGGCCATGGCTGG - Intergenic
1193364867 X:80620227-80620249 TAGCCAGGTCTGGCAATGCATGG - Intergenic
1198047084 X:132913655-132913677 CAGCCAGCGATGGCCATGCCTGG - Intronic
1199413703 X:147555571-147555593 TAGGCAGGGCTGGCCCTGTTTGG - Intergenic
1202594460 Y:26521811-26521833 TGGCCAGGGCTGGCCAAGAGGGG - Intergenic