ID: 903058651

View in Genome Browser
Species Human (GRCh38)
Location 1:20654324-20654346
Sequence CTGGAGCCCAGCAATGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903058644_903058651 9 Left 903058644 1:20654292-20654314 CCGCTGAAGATGACGCGGGCATT 0: 1
1: 0
2: 0
3: 2
4: 44
Right 903058651 1:20654324-20654346 CTGGAGCCCAGCAATGAGGAGGG 0: 1
1: 0
2: 4
3: 42
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903058651 Original CRISPR CTGGAGCCCAGCAATGAGGA GGG Exonic
900423121 1:2564298-2564320 CTGCAGCCATGCCATGAGGATGG + Intronic
901065515 1:6492356-6492378 GTGGAGCCCAGCAAGGAGCTGGG + Intronic
901871807 1:12142776-12142798 CTGGATCCCAGCAGTGATGTTGG + Exonic
902135190 1:14299105-14299127 CTGTATCCCAGAACTGAGGATGG - Intergenic
902165943 1:14571808-14571830 CTGGAGCTAAGTAATGAGGATGG + Intergenic
902353326 1:15876187-15876209 CTGAAGCCCTGCATTTAGGAGGG - Exonic
902629669 1:17697141-17697163 TTGGAGCACAGCGAGGAGGACGG + Exonic
902793695 1:18786305-18786327 CTGCAACCCAGCAAGCAGGAAGG - Intergenic
903058651 1:20654324-20654346 CTGGAGCCCAGCAATGAGGAGGG + Exonic
903127816 1:21259652-21259674 CTGGAGCCAAGCTAAGAGGCAGG + Intronic
903438116 1:23367973-23367995 CTGGGACCCAGCCATGAGCAGGG + Exonic
903750805 1:25619203-25619225 ATGGTGCCCAGCAATGCAGAGGG + Intronic
903834957 1:26197821-26197843 CTGGAACCCAGGAATGAGATGGG + Intronic
904333900 1:29784840-29784862 CTGCTGTCCAGCACTGAGGATGG + Intergenic
904893926 1:33800056-33800078 CTGGAGCACAGCATTGTGGCAGG - Intronic
905786913 1:40765721-40765743 CTGTAGCTCAGCAAAGATGATGG - Intronic
906152848 1:43598032-43598054 CTGGTGCGCACCGATGAGGACGG + Exonic
906302658 1:44694754-44694776 TGGGATCCCAGCACTGAGGAGGG - Intronic
906713829 1:47952366-47952388 GTGGAGCCCAGCTATCAGAATGG - Intronic
908566744 1:65364652-65364674 ATGGAGCCCAGCTATGGGGGAGG + Exonic
909094913 1:71274634-71274656 CTGGAGTACAGCAATGAAGGAGG - Intergenic
909416642 1:75414000-75414022 ATGGAGCCCAGCAATCAAAAGGG + Intronic
909851970 1:80478053-80478075 CCTGAGCCCAGCAATGCAGATGG - Intergenic
910038538 1:82818886-82818908 CAAGAGCCCAGAAGTGAGGAGGG + Intergenic
911305515 1:96227222-96227244 TTGGAGGGCAGGAATGAGGAAGG - Intergenic
912717929 1:111995022-111995044 CTGGAGCCCAGCAAGTTGGATGG - Intergenic
914260121 1:145991969-145991991 CTGTAGCCCAGCTATGTGGGAGG + Intergenic
914450062 1:147783407-147783429 CTCCATCCCTGCAATGAGGATGG + Intergenic
915296232 1:154923729-154923751 CTGGCACCCAGCAAGGATGATGG + Intergenic
915318603 1:155043554-155043576 CTGGAGCCCTGCCCTGAGGGAGG + Intronic
915603444 1:156936815-156936837 CTGGGGCCCTGCCCTGAGGATGG - Exonic
917630225 1:176884249-176884271 CTGGAGCAAAGCCATGAGGCAGG + Intronic
919625802 1:199909098-199909120 CTGGAGACCACCAGTGAGGTTGG + Intergenic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
920640057 1:207743156-207743178 CTGAGGCCCTGCAATGAGAAGGG - Intergenic
923126193 1:231036643-231036665 CTGGAGCCCAGGGCTGAGAAGGG - Intronic
923256336 1:232224635-232224657 CTGCAGCCCAGCTATGAAGTGGG - Intergenic
1063936302 10:11082105-11082127 GTGGAGGGCAGGAATGAGGAAGG + Intronic
1063951666 10:11229067-11229089 CTGGAGCCCAGGAAGGTGGGAGG + Intronic
1065200008 10:23303875-23303897 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1065721450 10:28631840-28631862 CTTGAGCCCAGGAATGAGGTTGG + Intergenic
1066228059 10:33403828-33403850 CTGGAGCACAGCAGTGAGGTGGG + Intergenic
1068201173 10:53786293-53786315 CTGGATCTCAGGACTGAGGAGGG - Intergenic
1068673812 10:59749800-59749822 TTGCAGCCCAGCCATGAAGAGGG + Intergenic
1068834525 10:61539307-61539329 CTGGAGCTCAGAAATCAAGATGG + Intergenic
1069824314 10:71245945-71245967 ATGACGCCCAGAAATGAGGAGGG - Intronic
1070370609 10:75778536-75778558 CTGTAGTCAATCAATGAGGATGG + Intronic
1070849952 10:79555552-79555574 CTGCAGCCCAGCAGTGATGTTGG - Intergenic
1070854209 10:79593642-79593664 CTGCAGCCCAGCAGTGATGGTGG - Intergenic
1070857249 10:79615735-79615757 CTGCAGCCCAGCAGTGATGGTGG + Intergenic
1070920599 10:80183207-80183229 CTGGAGCCCAGAACTCAAGATGG + Intronic
1070961279 10:80501893-80501915 TTGCAGCCCAACAACGAGGAGGG - Intronic
1071100365 10:82029743-82029765 CAGGAGCCCTGCAGTGAAGATGG + Intronic
1071478836 10:86047638-86047660 TTGGAACCCAGCAATGATGCTGG + Intronic
1071598140 10:86942730-86942752 CTGGAGCCCAGCCACGACGCGGG - Exonic
1071983899 10:91031675-91031697 CTGGAGCACAGGAATGAGCATGG - Intergenic
1072374868 10:94804115-94804137 CTGGAGCTCTGCTTTGAGGATGG + Intronic
1072416251 10:95249191-95249213 GGGGAGCACAGCAAGGAGGAAGG - Intronic
1073618963 10:105027085-105027107 CTGGAGCACAGCGAGCAGGAGGG - Intronic
1074520956 10:114223414-114223436 CTGGAGCCCAAGATTGAGGAAGG - Intronic
1074563395 10:114554263-114554285 TTGGAGACCGGCAATGAGGCTGG - Intronic
1074921688 10:118020616-118020638 CTGCAGCCCAGCAGGGAGGCAGG - Intronic
1075532303 10:123240005-123240027 CTGGAGCCCAGCATTGAGCCTGG - Intergenic
1075964344 10:126598175-126598197 CTGGTGGGCAGCAATGAGCAAGG - Intronic
1076564741 10:131390413-131390435 TGGGAGCCCACCCATGAGGATGG - Intergenic
1076876671 10:133219665-133219687 CTGGAGTCCAGCAGAGAGCAAGG + Intronic
1077124020 11:924677-924699 GTGGAGCCCGGCCAGGAGGAGGG - Intergenic
1077172618 11:1174714-1174736 CTCAAGCCCAGCACAGAGGACGG - Intronic
1077480373 11:2811784-2811806 GTGGAGACCACCAAAGAGGAGGG + Intronic
1079093574 11:17496878-17496900 ATGGGGCCCAGAAATGGGGATGG - Intronic
1080684942 11:34507466-34507488 CTGGAGCACAGCAATTAGAATGG - Intronic
1080738101 11:35037112-35037134 GAGGAGCCCAACAAAGAGGATGG - Intergenic
1080785060 11:35467572-35467594 TTGAAGCCCTGCAATGAGGGTGG - Intronic
1080891973 11:36416964-36416986 CTGGAGAGCAGCACGGAGGAGGG - Intronic
1081709680 11:45208791-45208813 CTGGGGGCCAGCAATTAGGAAGG + Intronic
1081754177 11:45532837-45532859 CTGGAGCTCAGAAATGGGGCTGG - Intergenic
1083356336 11:62069057-62069079 CTGGAGGCCAGCAAGGAAGCTGG + Intergenic
1083613102 11:64013751-64013773 CTGGAGCCCAGCCAAGAGGTGGG - Intronic
1084036379 11:66513797-66513819 CCGGAGCACAGCAATGGGAAGGG + Intronic
1085046180 11:73355058-73355080 CTGGAGCACAGCCCTGAGGCGGG + Intronic
1085270899 11:75269263-75269285 CTGGAGCCCCGCAGTGACCACGG - Intronic
1085336752 11:75702388-75702410 CAGGAGCCAGGGAATGAGGAGGG + Intergenic
1089754883 11:120679380-120679402 CCGGAGCCCAGGAAAGAGTATGG + Intronic
1090627768 11:128620926-128620948 CTGGAGCCTCGCAGAGAGGAGGG - Intergenic
1091406650 12:213576-213598 GTGGTGCCCAGCAAGGTGGAAGG - Intronic
1091502127 12:1028470-1028492 CTGGAGCCCAGAGCTGAAGAAGG + Exonic
1091509505 12:1107717-1107739 CTGGATGGCAGCAATGGGGAGGG + Intronic
1091548290 12:1518951-1518973 CTGGAGCCCAGGACTGGGTAGGG + Intergenic
1091665017 12:2412475-2412497 CAGGAGCCCAGCAGTGAGACAGG + Intronic
1091883642 12:4000218-4000240 CTGGAGTCAAACTATGAGGAGGG - Intergenic
1091999379 12:5019947-5019969 CTGTAGCTCAGCAATAAGAAAGG - Intergenic
1093643196 12:21552042-21552064 CAGAAGCCCAGGGATGAGGAAGG + Intronic
1095275438 12:40276930-40276952 CTTGAGCCCACCCAGGAGGATGG - Intronic
1096567286 12:52492492-52492514 CTGGTGCCCAGCAAGCAGCAGGG - Intronic
1096620040 12:52858753-52858775 CTGCAGCCCAGCAGGCAGGAGGG - Intergenic
1096770733 12:53934452-53934474 CTGGAGCCCAGAGAAGTGGAGGG + Intergenic
1096807443 12:54149190-54149212 CTGGAGCACAGCAATTACGCGGG - Intergenic
1097147978 12:56954702-56954724 CTGTCGCCCAGCACTCAGGAAGG + Intronic
1099670162 12:85681095-85681117 CTGGAGCTCAGCAAGCAGAAGGG - Intergenic
1099715073 12:86281638-86281660 CTGTATCCCAGCAATTAAGAAGG - Intronic
1100718033 12:97326154-97326176 CTGGAACCCACCAGTGAGGCAGG - Intergenic
1101613791 12:106316410-106316432 CTGAAGCACAGCAAGCAGGAGGG - Intronic
1101992792 12:109501039-109501061 CTGCAAGCCAGCTATGAGGAGGG + Intronic
1102746546 12:115253720-115253742 CTGGAGCTCAGCATTCAGGAAGG + Intergenic
1103556728 12:121771020-121771042 CTGGGGCCCGGGAATGGGGAGGG + Intronic
1104328828 12:127825498-127825520 CTGGGGCAGAGCAGTGAGGACGG - Intergenic
1104349251 12:128030659-128030681 AGTGAGCCCAGCAAAGAGGAAGG - Intergenic
1105058939 12:133130227-133130249 CTGGAGGCAGGCACTGAGGACGG - Exonic
1105298405 13:19111481-19111503 CTTATGCCCAGGAATGAGGAAGG - Intergenic
1105696827 13:22897587-22897609 GAGGAGCCCAGCAAGGAGGAAGG - Intergenic
1105717398 13:23081099-23081121 CTCTAGCCCTGGAATGAGGAGGG - Intergenic
1106396393 13:29385045-29385067 CTGGAGCCCAGCAGAGTGGCTGG - Intronic
1106810017 13:33350193-33350215 CTGGAGCCCAGAGCAGAGGAGGG + Intronic
1106911571 13:34468762-34468784 AGGGACCCCAGCAATCAGGAAGG + Intergenic
1107794254 13:44033875-44033897 CAGGAACCAAGGAATGAGGATGG + Intergenic
1107988863 13:45799584-45799606 CTGGAGCTCAGGATGGAGGATGG + Intronic
1108346616 13:49552689-49552711 CTGCAGAACAGCAAGGAGGAAGG + Intronic
1108732836 13:53252880-53252902 CTGGGTCCCAGCAATGACGAAGG - Intergenic
1110571875 13:77013317-77013339 CTGGACCCCGGCAAGAAGGAGGG - Intronic
1113109469 13:106807001-106807023 CTGGAGGGCAGCAATGTGGCAGG - Intergenic
1113439076 13:110313868-110313890 CTGGAACCCAGCACCGAGGTAGG - Intronic
1113455007 13:110442205-110442227 CTGGGGCCCAGATGTGAGGATGG + Intronic
1114350039 14:21840076-21840098 CTGTAGGCCAGCAATGATGCAGG - Intergenic
1114520101 14:23328376-23328398 CAGGACCCCTGCAATGATGATGG - Intergenic
1114538952 14:23440764-23440786 CTGGACGCAAGAAATGAGGAAGG + Intergenic
1115975238 14:38989979-38990001 CTGGAGCTCAGGAAAGAGGTAGG + Intergenic
1117016088 14:51518657-51518679 CTGGACCTCAGAAATGAGAAAGG - Intronic
1117997785 14:61494118-61494140 CTGAAGCTCAGTAAAGAGGATGG + Intronic
1120712579 14:87808020-87808042 CTAGAGCCCAGAAAGGATGAAGG - Intergenic
1121165337 14:91791092-91791114 CTGTAGCCCAGCATGGAGTATGG - Intronic
1121322392 14:92999576-92999598 CTGAGGCCCAGCAAGGAGGAGGG - Intronic
1121496410 14:94394599-94394621 CTGGAGTCTAACACTGAGGAGGG + Intergenic
1121502987 14:94453262-94453284 GTGGAGCTAAGCTATGAGGATGG - Intergenic
1121643797 14:95503874-95503896 CTGGAACCCAGCACTTTGGAAGG - Intergenic
1122495930 14:102155382-102155404 CTGGAGCCCTGCAAGGATAAGGG + Intronic
1122844790 14:104486976-104486998 CTGGAGCAGAGTAATGAGAATGG - Intronic
1123008519 14:105335927-105335949 CTGGGGCCCAGCTACGAGGATGG + Intronic
1123188995 14:106549998-106550020 CAGGAGAACAGCAAAGAGGAAGG - Intergenic
1123405301 15:20016599-20016621 CTGGAGCACAGCCATGAGCCAGG - Intergenic
1123514631 15:21023247-21023269 CTGGAGCACAGCCATGAGCCAGG - Intergenic
1123587612 15:21773248-21773270 CTGCAGCCCAGAGATGATGATGG - Intergenic
1123624250 15:22215813-22215835 CTGCAGCCCAGAGATGATGATGG - Intergenic
1123935461 15:25191942-25191964 CTGCAGCCCTGCAGTGATGACGG + Intergenic
1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG + Intergenic
1124341873 15:28894943-28894965 CTGGAGCCCCCCAATGACGCAGG - Intronic
1125482247 15:40088867-40088889 CTGGACTCCTGCAATGAGGGTGG - Exonic
1125728552 15:41880442-41880464 GTGGGGCCCAGCAGTGAGGCAGG - Intronic
1127146337 15:56028075-56028097 ACTGAACCCAGCAATGAGGAGGG - Intergenic
1128705982 15:69837720-69837742 CTGGAGCTCAGCAGACAGGAAGG + Intergenic
1129113014 15:73349129-73349151 CTGGAGACCAGGAAGGAGGTGGG - Intronic
1129159534 15:73739671-73739693 CAGGAGCCCCGCAATGAGAACGG + Exonic
1129269794 15:74413589-74413611 CTGGAGCCAAGCAAGGATGGGGG + Intronic
1130913193 15:88284834-88284856 CTGGACCCAGGCAAGGAGGAGGG - Intergenic
1131183618 15:90257139-90257161 CTTGAAGCCATCAATGAGGAGGG - Exonic
1131831841 15:96359642-96359664 TTTGACCCCAGAAATGAGGATGG - Intergenic
1131966306 15:97847825-97847847 CTGGAGCCCAGTGATGAGTAAGG + Intergenic
1132336782 15:101052944-101052966 CTGGAGCACAGCGAGGACGAGGG + Exonic
1132497188 16:269432-269454 CTGGGGCCCTGCAGTGAGGTGGG - Intronic
1132551640 16:556173-556195 CTGGAGCCCAGAGCTGTGGAAGG - Intergenic
1132623759 16:880329-880351 CAGCAGCCCAGCCAGGAGGAAGG + Intronic
1132796710 16:1728036-1728058 CTGCAGCCCACCAATGGGGAGGG - Intronic
1132869251 16:2108379-2108401 CTGGTGCCCATCATTGAGGGTGG - Exonic
1133570368 16:7034450-7034472 CTGGAGCCCAGCAAGGAAGAAGG - Intronic
1133829066 16:9305073-9305095 GTGGAGCCCAAAAATGAGGCTGG + Intergenic
1133852359 16:9517395-9517417 CTGGGGCACAGCAAAGAGCATGG - Intergenic
1134550303 16:15135776-15135798 CTGGTGCCCATCACTGAGGGTGG - Intronic
1134718164 16:16367219-16367241 CTGGTGCCCATCACTGAGGGTGG + Intergenic
1134956588 16:18384940-18384962 CTGGTGCCCATCACTGAGGGTGG - Intergenic
1136062819 16:27738261-27738283 CTGGAGCCAGGGAAGGAGGAAGG + Intronic
1136287330 16:29252291-29252313 CGTGAGCCCAGCAGTGAGGCTGG - Intergenic
1136454844 16:30374633-30374655 CTGGAGCCCAGCGGGGAGGAAGG - Intronic
1136617693 16:31408642-31408664 CAGGAGCACAGCAGGGAGGAGGG + Intronic
1136999517 16:35216786-35216808 CAGGAGCCCAGGAAAGAGGAAGG - Intergenic
1137003433 16:35251220-35251242 CAGGAGCCCAGGAAAGAGGAAGG + Intergenic
1137032017 16:35532537-35532559 CAGGGGCCCAGAAAAGAGGAAGG + Intergenic
1138700446 16:58857224-58857246 CTGGGGCCTAGCATTGGGGATGG - Intergenic
1140541880 16:75763436-75763458 CTGGATCCCAGCAACCAGGGAGG - Intergenic
1142092943 16:88224920-88224942 CGTGAGCCCAGCAGTGAGGCTGG - Intergenic
1142132237 16:88436357-88436379 CTGGAGCCCAGCAGGGAAGCTGG + Exonic
1142904359 17:3032591-3032613 CTGAAGACCTGCAATGGGGAAGG + Intronic
1143059440 17:4187523-4187545 CTGGAGACCAGCACTGCAGAAGG - Intronic
1144038091 17:11385304-11385326 GTGGGGCGCAGCAATGAGGCTGG + Intronic
1144520224 17:15948060-15948082 TTGAAGCCAAGCAATAAGGAGGG + Intronic
1145007054 17:19344009-19344031 CTGGAGCCCAGCCACTGGGAAGG - Intronic
1145765100 17:27453581-27453603 CTGGAGGCCATCTGTGAGGAAGG + Intergenic
1146003998 17:29149382-29149404 CTAGAGACAAGCAATCAGGAAGG + Intronic
1146228151 17:31085211-31085233 CTGTAACCCAGCTATGAGGGAGG + Intergenic
1146307789 17:31743919-31743941 CTGGAGCCAGGCAGTGGGGATGG - Intergenic
1147611071 17:41802113-41802135 GAGGAGCTCAGCAGTGAGGAGGG + Exonic
1150073122 17:62169369-62169391 CTGCAGTCCAGGAATGATGAGGG + Intergenic
1150644234 17:66968279-66968301 GTGGAGCCCAGCTCTGAGGTTGG + Intronic
1150811722 17:68362174-68362196 ATGGGGGCCAGCAATGAAGACGG - Intronic
1151330190 17:73401945-73401967 CTGGTGCGCACCCATGAGGATGG - Exonic
1151554692 17:74840776-74840798 CTGGAGGCCAGCACTCTGGAAGG - Intergenic
1151598769 17:75093806-75093828 GTGGAGCACAGCCGTGAGGATGG - Exonic
1152309052 17:79538043-79538065 CTGGAGCCCAGCACAGGGGTTGG + Intergenic
1152398301 17:80048651-80048673 CAGCAGCCCAGCACCGAGGAGGG + Exonic
1152472551 17:80498500-80498522 CTGGTGCCCAGCTTTGAGGACGG - Intergenic
1152995995 18:406818-406840 CTGGAGCCCAGCACCGAGTGAGG - Intronic
1153312285 18:3688836-3688858 CTGGAGACCAGAAAGGAGGCCGG - Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1154146852 18:11873897-11873919 CTGGACCACAGCCATGAGGAGGG - Intronic
1155874206 18:31064836-31064858 CTGGAGTCCAGGAATGGAGATGG + Exonic
1155927593 18:31673471-31673493 CTGGTGGTCAGCAACGAGGATGG + Intronic
1156511890 18:37643944-37643966 CTGGAACCCAGCTAGGTGGAAGG + Intergenic
1157475223 18:48019732-48019754 CTGGGGACCAGCAGAGAGGAGGG - Intergenic
1157869790 18:51219325-51219347 CTGGAGGCCACCAATAAGGTAGG + Intergenic
1159527815 18:69616330-69616352 GGGCAGCCCAGCAATGAGCATGG - Intronic
1161227097 19:3151720-3151742 CTGGAGCGCATCACCGAGGAGGG + Exonic
1161496902 19:4591445-4591467 CTGGAGGCCAGGAAGGAGGAGGG + Intergenic
1163066050 19:14796201-14796223 TTAGAGCCCAGGAATGAGCAAGG + Intronic
1164397383 19:27877931-27877953 CTGGGACCCAGGAATCAGGAAGG + Intergenic
1164872808 19:31660447-31660469 CTGGATCCTAGCACAGAGGAAGG + Intergenic
1165116718 19:33533258-33533280 CTGGAAACCAGGAAGGAGGAGGG - Intergenic
1166094430 19:40530387-40530409 CTGGGGCCCCGCAAAGAGGCGGG + Intronic
1166282262 19:41802022-41802044 CTTGTGCCCAGGAATGAGCAAGG + Intronic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1167027099 19:46928539-46928561 CTGGAGCCAAACAGCGAGGAGGG - Intronic
1167412144 19:49350856-49350878 CTGAAGCCCAGCTTTGAGGCAGG - Intronic
1167664801 19:50817893-50817915 CAGGAGCCCTGCAATGGGGTGGG - Intergenic
1168248247 19:55125332-55125354 CTGTAGCCCAGGAATGATCAGGG - Intergenic
1168505131 19:56927723-56927745 CTGAAGACCAGGAATGATGAAGG + Intergenic
925636447 2:5945873-5945895 CTGTGGCCCAGCAGTGAGGGAGG + Intergenic
925905963 2:8539806-8539828 CTGGGGCCCTGCAGCGAGGACGG - Intergenic
927848523 2:26484626-26484648 CTGGTGCTCTGCAATGATGAGGG + Exonic
928445330 2:31329077-31329099 CTGGCCCCCAGCAGTGGGGATGG + Intergenic
928903662 2:36348342-36348364 CTGGAGCCATGAAATGTGGATGG - Intergenic
931158654 2:59664370-59664392 CCTGAGCCCACCAATGAGGGGGG - Intergenic
931463441 2:62467359-62467381 CTGCAGCCCAGAAAGGAGAAAGG + Intergenic
932593970 2:73082962-73082984 TGGGAGACCAGCCATGAGGAGGG - Intronic
932659837 2:73642424-73642446 CAGGAGCCAAGCAATAAGGCAGG - Intergenic
932666404 2:73702100-73702122 CAGGAGCCAAGCAATGAGGCAGG - Intergenic
932756525 2:74413674-74413696 GTGGAGACTAGCAATGAGGCAGG + Intergenic
934325569 2:92011173-92011195 CTGTAGCCCAGCTATTTGGAAGG + Intergenic
935081920 2:99806766-99806788 CTGGAGCCCAGCACAGTGTATGG + Intronic
935203788 2:100880844-100880866 CAGGAGCACAGCAGGGAGGAGGG + Intronic
935400553 2:102655948-102655970 CTTCATCCCACCAATGAGGAAGG + Intronic
937084934 2:119165282-119165304 CTGGGGCACAGCAAAGAGGCTGG + Intergenic
938083242 2:128381298-128381320 CTGGAGACCAGGCCTGAGGAGGG + Intergenic
938115155 2:128597498-128597520 CAGTGGCCCAGCAATGGGGAGGG + Intergenic
939932281 2:148250438-148250460 GTGGGGCCCAGCAAAGAAGAAGG - Intronic
940078107 2:149766701-149766723 CTGGAGCCTGGCAAAGAGAAGGG + Intergenic
941580902 2:167294023-167294045 CTGGAGCGCAGACTTGAGGATGG + Intergenic
946745641 2:222842928-222842950 GTGGAGCCCAGCAAAGAGATGGG - Intergenic
948537700 2:238658441-238658463 TTGGGGCCCAGGAACGAGGAGGG + Intergenic
948715549 2:239858825-239858847 CTGAAGCCCTCCAATGTGGAAGG + Intergenic
948758045 2:240170418-240170440 CTGGAACTCTGCACTGAGGAAGG - Intergenic
948816296 2:240511958-240511980 CTGAAGCTCAGCAATGAGCCAGG - Exonic
948864901 2:240770288-240770310 CTGGTGCCCAGCAATGGGCCGGG - Intronic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1169260373 20:4134093-4134115 CTTGAGCCCAGGCAGGAGGATGG + Intronic
1171110436 20:22475994-22476016 CTGAAGCCCAGCAATGTGTACGG + Intergenic
1171280846 20:23896482-23896504 CGGGAGCTAAGCTATGAGGATGG + Intergenic
1172815852 20:37685381-37685403 CTGTAACTCAGCACTGAGGATGG + Intergenic
1175521614 20:59605492-59605514 CTGGGGCCCGGCAGTGGGGAGGG - Intronic
1175877203 20:62235992-62236014 CCCCAGCCCTGCAATGAGGAAGG - Intronic
1175885972 20:62291117-62291139 CTGCATCCCAGCACTTAGGAGGG - Intronic
1175968655 20:62672914-62672936 GTGGTCCCCAGCACTGAGGATGG + Intronic
1176271377 20:64236669-64236691 CTGGCACCCAGCCATGAGCAGGG - Intronic
1178828418 21:36034704-36034726 CTGGAGCCCAGCCATGCAAATGG + Exonic
1178985263 21:37297931-37297953 CTGGCCTCCAGCAATGAAGAAGG + Intergenic
1179085025 21:38208230-38208252 CTGGAGCCCAGGAAGCAGGAAGG - Intronic
1179154382 21:38837015-38837037 CAGGTCCCCAGCAAGGAGGAGGG + Intergenic
1179197558 21:39179698-39179720 CTGTACCTCAGCATTGAGGACGG + Intronic
1179774058 21:43648340-43648362 ATGAAGCCCAGCAGGGAGGATGG - Intronic
1179837910 21:44049681-44049703 CCAGAGCTCAGCAGTGAGGAGGG - Intronic
1181695161 22:24589294-24589316 CTCCACCCCAGCAAGGAGGAGGG + Intronic
1181891157 22:26064857-26064879 CTGGACCCCAGCACAGAGGCTGG + Intergenic
1182032979 22:27174751-27174773 CTGCAGTCCAGCAGAGAGGAAGG + Intergenic
1183282008 22:36937141-36937163 CTTGAGCTCAGCATGGAGGATGG + Intronic
1183343042 22:37292580-37292602 CTGGAGCCAAGTGATGGGGAAGG + Intronic
1184034657 22:41912750-41912772 CTGAAGCCCAGAAAGGAGAAGGG + Intronic
949552590 3:5123163-5123185 CTGGAGCTCAGCAATGAGCTTGG - Intronic
950087500 3:10270641-10270663 CTGGAGCCAAGCCTAGAGGAGGG + Exonic
950170442 3:10835307-10835329 CTGGACCCCAGCCATGGGGTGGG + Intronic
950358964 3:12437018-12437040 GTGGAGCCCAGGAACGAAGAGGG + Intergenic
950495495 3:13331633-13331655 CTGGAGCCCAGCATGGAGCCTGG + Intronic
950539940 3:13606014-13606036 CTTGAGCCCAGGGATGGGGAGGG - Intronic
952395392 3:32916471-32916493 CTTGAGCCCAGGAGGGAGGAGGG + Intergenic
952918349 3:38266686-38266708 TTGAAGCCCAGCAAGCAGGAAGG - Intronic
953627855 3:44585385-44585407 CTGGGGCCCAGAGAAGAGGACGG + Intronic
953931579 3:47008431-47008453 CTGGGGCCCAGGTATGGGGAAGG + Exonic
954390202 3:50264729-50264751 CTGGAGCCCGGCAGGGTGGAGGG - Intergenic
954607925 3:51928511-51928533 CTGGAGCCCAGAATGGAGGGAGG + Intergenic
954661435 3:52228949-52228971 CTGGAGCCCAGGAAGGAGGATGG + Exonic
955075515 3:55609509-55609531 CTGGAGCCAAGAGATGTGGAGGG + Intronic
955456632 3:59128760-59128782 CTGGGGCCCTGCCAGGAGGAAGG - Intergenic
955476125 3:59338068-59338090 TTGAGGCCCAGCAAAGAGGATGG + Intergenic
955520132 3:59767597-59767619 CTGGAGCCCAACATTAAGGATGG + Intronic
956260510 3:67335666-67335688 CCAGAGCCCAGCAAAAAGGATGG + Intergenic
956695676 3:71917231-71917253 CTACAGCACAGCAAAGAGGACGG + Intergenic
956748561 3:72328859-72328881 CTGGAGCACAGCATCTAGGATGG + Intergenic
957558611 3:81792875-81792897 CTGGAACCCAGGAAGGTGGAGGG + Intergenic
958814451 3:98901114-98901136 CTGGAGCCCAGCAAGGTGAGTGG - Exonic
965347494 3:167570153-167570175 TTGGTGCCCAGCAAAGAGGCAGG + Intronic
966501021 3:180639563-180639585 CAGGAGCTAAGCTATGAGGATGG + Intronic
967479414 3:189956782-189956804 CTGGATAGCAGCAATGAGGAGGG + Exonic
968292475 3:197549376-197549398 AGTGAGCCCAGCAGTGAGGAAGG - Intronic
968628224 4:1637577-1637599 CAGGAGCCCTGCAGTGGGGAAGG + Intronic
969205841 4:5644684-5644706 CTGGAGCCCAGGTATGGGAAGGG - Intronic
969218547 4:5743673-5743695 CTGCATCCCAGGAAGGAGGAAGG + Intronic
969652741 4:8477567-8477589 CAGGAGCCCAGCACTGAGGGTGG + Intronic
976371467 4:84293380-84293402 CTGGAGTCAAGAAATGAAGAGGG - Intergenic
976981886 4:91242214-91242236 CTGGAGCCTAGTAAAGTGGACGG + Intronic
979001939 4:115232503-115232525 CTGGAGCCCAGAAATGCAGAAGG - Intergenic
979726801 4:123972144-123972166 TTGTTCCCCAGCAATGAGGAGGG + Intergenic
980856896 4:138451347-138451369 ATGAAGCCCACCAATGAGGGTGG - Intergenic
983042285 4:162943954-162943976 CTGTAGGCAAGCAATGGGGAGGG + Intergenic
985196591 4:187436904-187436926 CTGGTGCCCATCACAGAGGAAGG - Intergenic
986156474 5:5181775-5181797 CTGGACTCCAGGAATGAGAAAGG - Intronic
986419569 5:7565171-7565193 AAGGAGCCCAGCAAGGAGAAAGG - Intronic
987136093 5:14900918-14900940 CTGGAGCCCTTCAGAGAGGAAGG + Intergenic
987379941 5:17275631-17275653 GAGGAGCCCAGCAAGGAGGAAGG + Exonic
991184225 5:63788525-63788547 TTGGTGTCCTGCAATGAGGAAGG + Intergenic
992051800 5:72947977-72947999 CTGGAGCCCAGGACAGAGGTTGG - Intergenic
992239264 5:74749093-74749115 CTTGAGCCCAGCAGGGAGGTTGG - Intronic
994091873 5:95816995-95817017 CTGGGTCACAGCAATCAGGAAGG + Intronic
996837807 5:127813175-127813197 CTGGGCCCCCGCAATGAGGAAGG - Intergenic
997471669 5:134120705-134120727 CTGGAGCCAAGGGATGAGGAGGG - Intronic
998131298 5:139652395-139652417 CTGGATTCGAGCAATGAGAAAGG + Intronic
998407772 5:141883525-141883547 CCGGAGTCCAGCAGTGAGGTGGG - Intergenic
1000437938 5:161236279-161236301 CTTGAGATCAGCAATTAGGAGGG - Intergenic
1001053911 5:168434039-168434061 CTGGAGCCCAGAGATGGGGGTGG + Intronic
1001054312 5:168436482-168436504 CTGGAGCCCTGCACTTGGGATGG - Intronic
1001565936 5:172699573-172699595 CTGGCCCCTGGCAATGAGGATGG - Intergenic
1001733231 5:173975543-173975565 TTGGAGCTAAGCTATGAGGATGG - Intronic
1001860835 5:175053404-175053426 GTGGAGACCAGCAATGCAGATGG - Intergenic
1005342746 6:24858638-24858660 CAGGAGTCTATCAATGAGGAAGG + Intronic
1006774332 6:36580328-36580350 CTTGAGCCCAGCCATAAGGGAGG - Intergenic
1013606866 6:111758766-111758788 CTGCAGCCCAGCATTTAGGACGG + Intronic
1015502096 6:133945181-133945203 CTGGAGCTCAGCCATGATGAGGG - Intergenic
1015534931 6:134258183-134258205 CTTGAGCCCAGGAATGAGGAGGG - Intronic
1015844487 6:137505609-137505631 CTGGAAACTAGCAATGAGGATGG + Intergenic
1016511780 6:144850573-144850595 CTGGAGTCCAGAGAAGAGGAAGG - Intronic
1017039329 6:150295151-150295173 TTGGAGCCCAGCTATGGGAAGGG + Intergenic
1017948349 6:159115169-159115191 CTGGAAACCAGCTCTGAGGAAGG + Intergenic
1018045145 6:159959405-159959427 CAGGACCCCAGCATTGATGATGG - Intergenic
1018573356 6:165233538-165233560 CTGGAAGCCAGCACTGTGGAAGG + Intergenic
1018669871 6:166168976-166168998 CGGGAGCCCAGGAAGGGGGAAGG + Intergenic
1018713195 6:166512490-166512512 CAGGGACCCAGGAATGAGGAAGG - Intronic
1018910578 6:168098918-168098940 CTGGGGTCCACCTATGAGGAGGG + Intergenic
1018915935 6:168132349-168132371 CTGGTGCCCACCACTGGGGAAGG - Intergenic
1019022337 6:168929930-168929952 CTGGAGCCGTGCAAAGAGGGAGG - Intergenic
1019053744 6:169205196-169205218 TTGGAGCCCAACACTGTGGAGGG + Intergenic
1019355585 7:577150-577172 CAGAAGCCCAGCAATGCGGCTGG - Intronic
1019915579 7:4130076-4130098 CTGGAGCGCACCAAAGACGATGG + Exonic
1022124765 7:27345152-27345174 CTGGAGCCCAGCACTGAGGCTGG - Intergenic
1022741817 7:33129304-33129326 CCGGAGCCCAGGCAGGAGGAGGG + Intronic
1023212931 7:37827738-37827760 CTGGAGCCCAGGGATAAGGAGGG - Intronic
1023856675 7:44188405-44188427 CCTGAGCCCAGCAGTGAGCAAGG - Intronic
1024517012 7:50267680-50267702 CTGGAGCTCAGCAAAGAGTCTGG + Intergenic
1024543712 7:50500018-50500040 CAGGACCCCAGCACTGAGTAGGG + Intronic
1024802133 7:53092269-53092291 CTGGAGGCCACAAATGAGCAAGG - Intergenic
1025096777 7:56102071-56102093 CTGGAACCCAGCACTCTGGAAGG - Intronic
1025724384 7:64043940-64043962 TTGGAGGCCAGCTAGGAGGAGGG - Intronic
1029211858 7:98915948-98915970 ATGAAACCCAGCAATCAGGATGG - Intronic
1030345267 7:108426313-108426335 CTAGAGCACAGTAATGAAGAAGG - Intronic
1030573136 7:111251730-111251752 CTGGGGCCCATTGATGAGGATGG + Intronic
1030929825 7:115508500-115508522 CTGCAGCTCTGCAATCAGGAAGG - Intergenic
1032186590 7:129732017-129732039 CTGGGGACCAGCAGAGAGGAAGG - Intronic
1032763384 7:134966120-134966142 CTGGAGACCAACAATAAGCAAGG + Intronic
1032854207 7:135820875-135820897 CTAATGGCCAGCAATGAGGAAGG + Intergenic
1033607861 7:142940589-142940611 CTGGAGCCCAGGAGGGAGGGAGG - Exonic
1034483715 7:151343003-151343025 CTGGAGCCAAGCAATTTGAAAGG - Intronic
1034551258 7:151822252-151822274 CTCGAGCCCAGGAACGAGGTGGG + Intronic
1034627461 7:152504397-152504419 CTGAAGAGCAGCAATGAGCAAGG - Intergenic
1035074888 7:156170636-156170658 CTGGTGCTCAGCAAGGTGGACGG - Intergenic
1035590273 8:807836-807858 CTGGTGCACAGGAATAAGGAAGG + Intergenic
1035778705 8:2209757-2209779 CTGGATCACAGCAAAGAGGGAGG + Intergenic
1035909319 8:3548501-3548523 CAGGAGCTAAGCTATGAGGATGG - Intronic
1038382673 8:27111429-27111451 GTGGAGCTAAGCTATGAGGATGG - Intergenic
1038385365 8:27139656-27139678 CAGGACCCCAGCAAGGAGCAAGG - Intergenic
1039226213 8:35391278-35391300 CTGGAGCTGAGAAATGATGATGG - Intronic
1039414093 8:37378970-37378992 CTTGAGCTCAGCAGTGGGGAAGG - Intergenic
1039782292 8:40797381-40797403 CTGGGGCCCAGCACGCAGGATGG - Intronic
1042805365 8:72765177-72765199 CTGAGCCCCAGCAATTAGGATGG + Intronic
1046944888 8:119965257-119965279 CTGCAGCCCAGGGAGGAGGAAGG + Exonic
1047759663 8:127944895-127944917 CTGGACCTCAGCCATGAGCACGG - Intergenic
1048685025 8:136895106-136895128 CTGGAGCCCAGGACTGAGCCTGG + Intergenic
1048774045 8:137925784-137925806 CTGTAGCCCAGCATTGGAGAGGG - Intergenic
1048982142 8:139708330-139708352 ATGGAGGCCAGCTATCAGGATGG - Intergenic
1049211229 8:141387287-141387309 CTGGAGCTCAGCAGGCAGGAGGG - Intergenic
1049439615 8:142603147-142603169 ATGGAGCCCTGCACAGAGGACGG + Intergenic
1050085397 9:1959803-1959825 GTGGAGCCCAGCAATGTGTGAGG - Intergenic
1051963715 9:22800754-22800776 GTGGAGCCCAAGACTGAGGAAGG + Intergenic
1052023325 9:23548943-23548965 CTGGAGCTTAGCAACCAGGAAGG + Intergenic
1053128981 9:35604970-35604992 CTGGAGCCCAGGAATCCGGCAGG + Intergenic
1054804755 9:69387079-69387101 CTGGAGCCCTCCATTGTGGAAGG + Intronic
1059182138 9:112226283-112226305 CTGGAGACCAGCAGGGAGGCCGG + Intronic
1060427143 9:123515818-123515840 CTTGAGCCCAGGAAGGAGGTGGG + Intronic
1060591742 9:124821114-124821136 CTGGTGCTGAGCCATGAGGAAGG - Intergenic
1060615130 9:125006311-125006333 CTGGAGACCAGCCAAGAGGCGGG + Intronic
1060978004 9:127776708-127776730 CTGAGGCCCAGCAATGGGGAGGG + Intronic
1061448603 9:130656306-130656328 CTGAATCCCAGCAAAGCGGATGG - Intergenic
1061821943 9:133233825-133233847 CTGCAGGCCACCAAGGAGGACGG - Intergenic
1062123602 9:134847806-134847828 CTGGAGCCCAGCGGGCAGGAAGG + Intergenic
1062237355 9:135516689-135516711 CTGCAGGCCACCAAGGAGGACGG + Intergenic
1062495765 9:136830871-136830893 CTGGTGCCCAGCAGGAAGGATGG + Intronic
1185459370 X:327831-327853 CTGCAGCCCAGGGATGATGACGG + Intergenic
1185827033 X:3261343-3261365 CTGCAGACCAGGAAGGAGGAAGG + Intergenic
1186750761 X:12619488-12619510 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1187437089 X:19281767-19281789 CTAGAGCAAGGCAATGAGGAGGG + Intergenic
1188642663 X:32525368-32525390 CTTTATGCCAGCAATGAGGATGG + Intronic
1189301701 X:39957044-39957066 CGAGAGCCCAGCACTGAGCAGGG + Intergenic
1189980633 X:46506819-46506841 ATGGAACCCAGCAATGCAGAGGG + Intronic
1191945665 X:66531815-66531837 GTGGAGCCCAAGACTGAGGAAGG - Intergenic
1192156943 X:68753692-68753714 CTGGGGGCCTGCAAGGAGGAGGG + Intergenic
1192263525 X:69523495-69523517 CTGCAGCCCAGCTGGGAGGAGGG + Intronic
1194960012 X:100224288-100224310 CTGACGCCCAGGAATGAAGAAGG - Intergenic
1195254455 X:103079157-103079179 ATGGAGCCCAGCCAGGGGGAGGG + Intronic
1196039238 X:111184033-111184055 CTGAAGCCCAGAAAGCAGGAAGG - Intronic
1197732509 X:129823316-129823338 CTGGAGGGCAGCATTGAGGAAGG - Intronic
1198692214 X:139296657-139296679 CTGGGTCCCAGCAAAGAGAATGG - Intergenic
1199698045 X:150357784-150357806 CAGGAACACAGGAATGAGGACGG - Intergenic
1200115548 X:153768289-153768311 CTGGCGGCCAGCAATGGGGCTGG - Exonic