ID: 903059204

View in Genome Browser
Species Human (GRCh38)
Location 1:20657822-20657844
Sequence TACTCTCCTTTGGAGAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903059200_903059204 9 Left 903059200 1:20657790-20657812 CCTCTCATGCTACATTCAAAAAG 0: 1
1: 0
2: 2
3: 15
4: 140
Right 903059204 1:20657822-20657844 TACTCTCCTTTGGAGAGGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 174
903059199_903059204 15 Left 903059199 1:20657784-20657806 CCTCTGCCTCTCATGCTACATTC 0: 1
1: 0
2: 0
3: 29
4: 255
Right 903059204 1:20657822-20657844 TACTCTCCTTTGGAGAGGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 174
903059198_903059204 28 Left 903059198 1:20657771-20657793 CCTATATTCTCTACCTCTGCCTC 0: 1
1: 0
2: 2
3: 39
4: 406
Right 903059204 1:20657822-20657844 TACTCTCCTTTGGAGAGGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903059204 Original CRISPR TACTCTCCTTTGGAGAGGCC AGG Intronic
903006482 1:20302245-20302267 TAGTCTCCTTTGGTGGGGGCAGG - Intronic
903059204 1:20657822-20657844 TACTCTCCTTTGGAGAGGCCAGG + Intronic
905515396 1:38558630-38558652 TCGTCTCCTCTGAAGAGGCCAGG + Intergenic
907405098 1:54249009-54249031 TACACTGCTTGGGTGAGGCCAGG + Intronic
907461251 1:54607118-54607140 CACGCTCCTGTGGGGAGGCCGGG - Exonic
908762508 1:67525035-67525057 TACACTCAGTTGGAGAGGCATGG - Intergenic
908991312 1:70093950-70093972 TTCTCTCATTTGCAGAGTCCTGG - Intronic
909675295 1:78232788-78232810 AACTTTCCTTTGGAGAGAGCTGG - Intergenic
912598600 1:110904035-110904057 TCCTCTCCTTTGGAAAGGGGAGG + Intergenic
913700791 1:121372574-121372596 GACTCTCCTCTGGATAGGACTGG - Intronic
914041340 1:144053036-144053058 GACTCTCCTCTGGATAGGACTGG - Intergenic
914136744 1:144907450-144907472 GACTCTCCTCTGGATAGGACTGG + Intronic
914930639 1:151929394-151929416 TTCTCTCTTTTGAAAAGGCCTGG + Intergenic
915802505 1:158809120-158809142 TCCTCTCCTTTGTAGAGGTGTGG - Intergenic
916174308 1:162024759-162024781 TAATATCCTTTGAAGGGGCCTGG - Intergenic
916434949 1:164769287-164769309 TGCTCACCTTTGTAGGGGCCAGG - Intronic
916496714 1:165354239-165354261 TTCTCCCCTTCCGAGAGGCCCGG + Intronic
916867868 1:168879662-168879684 TATACTCCTATAGAGAGGCCAGG - Intergenic
918165279 1:181938952-181938974 TACTCTCCTTTGGTTACCCCAGG - Intergenic
918448044 1:184633877-184633899 TCCTCTCATGTGGAGCGGCCAGG + Intergenic
920488210 1:206391307-206391329 GACTCTCCTCTGGATAGGACTGG - Intronic
921264870 1:213414084-213414106 TACTCTGATTTTGACAGGCCTGG + Intergenic
921812383 1:219529617-219529639 CACTCTAATTTGGAGAGGACTGG + Intergenic
922548629 1:226477385-226477407 TACACTCCTTGGGTGAGGTCAGG + Intergenic
923027470 1:230217398-230217420 TGCTGTCCTTTAGATAGGCCTGG - Intronic
924154550 1:241162679-241162701 TTCTTTCCTTTGAAGAGGCAAGG + Intronic
1063473328 10:6306725-6306747 TGCTCTCCTTTGCAGGGCCCAGG - Intergenic
1064430994 10:15269728-15269750 TGCTCTCCATTGGAGAGGAAAGG + Intronic
1066192098 10:33065478-33065500 TACTCTGGTTTGGAGCTGCCTGG + Intergenic
1069663819 10:70141684-70141706 AAGTCTACCTTGGAGAGGCCTGG - Intronic
1069875655 10:71561434-71561456 TAGCCACCTCTGGAGAGGCCTGG + Intronic
1075684939 10:124357236-124357258 CAGTATCCTTTGGAGAGGCAGGG + Intergenic
1076902068 10:133344554-133344576 TCTTCTCCTTTGTAGAGGACAGG + Intronic
1077381079 11:2237923-2237945 CACTCTCCTTTGGAGAGACAGGG + Intergenic
1080368465 11:31607427-31607449 TTCTCTCCTTTGGAGAATGCAGG - Intronic
1082803842 11:57433950-57433972 TCCTCTCCTTTGGACAGTGCTGG + Intergenic
1084554869 11:69869561-69869583 TGCTCTCCTTCAGAGGGGCCGGG - Intergenic
1084776403 11:71379758-71379780 TACACTCCTTTGGAGAAATCAGG + Intergenic
1086150061 11:83599282-83599304 TACTCTCCTCTGGAGGGGTTAGG - Intronic
1088569507 11:111208444-111208466 TACTCTCCTTAAGTAAGGCCAGG - Intergenic
1089070821 11:115698236-115698258 TTCTCTCCTATGGAGAGGACTGG + Intergenic
1089502569 11:118940969-118940991 TATCCTCCTTTGGAGAGGTGGGG - Intronic
1089747448 11:120627309-120627331 GCTTCTCCTTTGGAGAGGACCGG - Intronic
1090334836 11:125955232-125955254 ATCTCTCCTTTGGATAGGTCAGG - Intergenic
1090863801 11:130677158-130677180 TCCTCTGCTTTGGAGAGCCTGGG - Intronic
1092523281 12:9294365-9294387 CAGACTCCTTAGGAGAGGCCTGG + Intergenic
1092544013 12:9437534-9437556 CAGACTCCTTAGGAGAGGCCTGG - Intergenic
1094508936 12:31084515-31084537 CAGACTCCTTAGGAGAGGCCTGG + Intronic
1095525193 12:43117061-43117083 TAGTCTCCTTTGGAGAAGGCTGG + Intergenic
1096304589 12:50463291-50463313 TACTCACCTTTGGCCAGGCATGG + Intronic
1096464526 12:51841012-51841034 TCCTCGCCTTTGGTAAGGCCTGG - Intergenic
1100825390 12:98470124-98470146 TATTCTCTGTTGGTGAGGCCAGG + Intergenic
1105270135 13:18865503-18865525 TTCTCTCCTGTGGAGTGCCCGGG - Intergenic
1107948583 13:45442295-45442317 AAGTCTTCTTGGGAGAGGCCGGG + Intergenic
1109462561 13:62680652-62680674 TACTCACCTTCTGAGAGGCAGGG - Intergenic
1110075672 13:71239221-71239243 AACTCTCCTTTTCAGAGGGCAGG - Intergenic
1112133163 13:96546391-96546413 TTCTCTCCTTTGGCAAGGGCAGG + Intronic
1115172093 14:30520155-30520177 TTCTCTCCTTTGTAAAGGCAGGG - Intergenic
1115656202 14:35446009-35446031 AACACTGCTTGGGAGAGGCCTGG - Intergenic
1116571740 14:46525988-46526010 AACTCTTCTTTGGAGAGGGGTGG - Intergenic
1118106219 14:62663025-62663047 TACTTTCATTTAGAGAGGGCAGG + Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1122099977 14:99400404-99400426 TGCTCTACTTTGGAGAGTCTAGG - Intronic
1122289877 14:100674822-100674844 TTCTCCCCTTTGGGGAGGTCTGG + Intergenic
1122393051 14:101403516-101403538 TATTTTCCTTCGGGGAGGCCAGG - Intergenic
1123024400 14:105417895-105417917 TCCTCTCCGCTGGGGAGGCCTGG + Intronic
1123035805 14:105471443-105471465 TACTCTCCCTGAGCGAGGCCTGG - Intergenic
1126783202 15:52155846-52155868 AACTCTCCAGTGGAGAGACCTGG - Intronic
1127460495 15:59194270-59194292 TTCTCTCCTCTGAAGAAGCCAGG - Intronic
1128758041 15:70196471-70196493 AACTCTCCCTGGGAGGGGCCTGG - Intergenic
1130727527 15:86455100-86455122 TATTCTCCCAGGGAGAGGCCAGG - Intronic
1136617477 16:31407425-31407447 TCCTCTCATCTGGAGAGGCTGGG - Intronic
1140300219 16:73750062-73750084 TACTCTCCTGTGGAGAGTCAAGG + Intergenic
1140444335 16:75012816-75012838 TGCTTTCCTTTGGAGAGTCATGG + Intronic
1140896589 16:79330332-79330354 TAGACTTCTTTGGAGATGCCAGG + Intergenic
1141166022 16:81661626-81661648 CGCTGTCCTTTGGAGAGGCGTGG + Intronic
1142115223 16:88352904-88352926 TCCCCTCCGTTGGAGAGGCCTGG + Intergenic
1142482456 17:227391-227413 AGCTGTCCTGTGGAGAGGCCTGG + Intronic
1143695810 17:8616587-8616609 TAGTTTTCTTTGTAGAGGCCAGG - Intronic
1145963579 17:28901610-28901632 CACTCTCCTGTGGAGAGGCAAGG + Exonic
1149650347 17:58272637-58272659 TAATATGCTTTGGAGAGGGCAGG + Intronic
1149806197 17:59620053-59620075 TCCTCTCCCTTGGAGAGCCCGGG + Exonic
1150919534 17:69468669-69468691 TTCTCTCCTTTGGACACCCCTGG - Intronic
1152106020 17:78329612-78329634 TCCCCTCCTTTGTGGAGGCCGGG + Intergenic
1154417905 18:14194469-14194491 TTCTCTCCTGTGGAGTGCCCGGG + Intergenic
1157632911 18:49117786-49117808 TGCTCTCCTTTGGTTAAGCCTGG + Intronic
1159939101 18:74392511-74392533 TCCGCTCCTCTGGAGAGCCCTGG + Intergenic
1165272512 19:34723205-34723227 TCCTCTCCTGGGGAGCGGCCAGG + Intergenic
1167215455 19:48161445-48161467 GACTCTCCGGTGAAGAGGCCAGG - Exonic
925788056 2:7452320-7452342 TGATCTGCTTTGAAGAGGCCAGG - Intergenic
931436707 2:62253896-62253918 GACTCTTCTTTGGCCAGGCCTGG - Intergenic
932614153 2:73221339-73221361 AGCTCTCCTTTGGGAAGGCCAGG - Intronic
936485072 2:112918464-112918486 TCCTCTCCTGTGTAAAGGCCTGG + Intronic
936665031 2:114585165-114585187 CACTCTCCTTTGGAGACTCTAGG + Intronic
936748699 2:115613934-115613956 TTCCCTCCTGTGGAGAGGCATGG - Intronic
940237553 2:151527276-151527298 TATTCTCCTTTGGCTGGGCCTGG - Intronic
940661341 2:156548809-156548831 TACTCTACATTGCAGGGGCCAGG - Intronic
941046146 2:160677783-160677805 ACCTCTCCTTAGCAGAGGCCTGG - Intergenic
943670956 2:190659716-190659738 TGCTCTCCTTTGGGGACGCGGGG - Exonic
943822203 2:192339674-192339696 TAATCTCCCTTGGAGTGACCAGG + Intergenic
948802694 2:240440036-240440058 TTCTCTCCTGTGAAAAGGCCCGG - Intronic
1168909489 20:1435982-1436004 TACTGTCTTTTGGAGATGCCTGG - Intergenic
1172792609 20:37516241-37516263 TACTCTCCTGTGGCGACACCTGG - Intronic
1173210090 20:41025625-41025647 TAGTCTTCTTTGGAGGGGCCTGG + Intergenic
1175325581 20:58125570-58125592 TTCTCTACTTTGGTGAGGGCCGG - Intergenic
1175726650 20:61323081-61323103 TACTCAAATTTGGAGAGGCGAGG - Intronic
1176855393 21:13964801-13964823 TTCTCTCCTGTGGAGTGCCCGGG - Intergenic
1178585454 21:33867370-33867392 TTCTCTGCATTGGAGAGGGCTGG + Intronic
1179960483 21:44764742-44764764 AGCTCTCCTTCGGACAGGCCTGG + Intergenic
1179965564 21:44802538-44802560 TCCTCAACTGTGGAGAGGCCGGG - Intergenic
1180164098 21:46011486-46011508 TTCTCTTCCTTGGAGAGGACAGG + Intergenic
1181138657 22:20787477-20787499 TACCCTCCTTGGGAGAGGTAAGG - Exonic
1182025241 22:27112983-27113005 TACTCTTCTGTGCAGAGGGCAGG + Intergenic
1182570059 22:31230280-31230302 CTCTCTCCTTAGGAGAGGCCAGG + Intronic
1183512239 22:38243121-38243143 TAAACTCCCTGGGAGAGGCCAGG + Intronic
1183804776 22:40199326-40199348 AACTTTCCAATGGAGAGGCCTGG + Intronic
1184670654 22:46010974-46010996 CACTCTCCTGGGGAGGGGCCAGG - Intergenic
949971362 3:9408042-9408064 TACTTTCCTTGGGACAGTCCTGG + Intronic
951277745 3:20710520-20710542 TCCTCTCCTTTGGGGGTGCCTGG - Intergenic
954334732 3:49909637-49909659 GACCCCTCTTTGGAGAGGCCAGG + Intronic
955639272 3:61064831-61064853 GACTCTCCTTTGGGGAGTCAAGG - Intronic
956043284 3:65169242-65169264 TTTGCTTCTTTGGAGAGGCCTGG - Intergenic
956731440 3:72200308-72200330 TTGTCTCCTTTGGAAAGGCTAGG - Intergenic
959523423 3:107346624-107346646 TACTCACTTTTGGAGGGGTCAGG + Intergenic
960320453 3:116228775-116228797 TAATCTCCCTTTGAGAGCCCGGG - Intronic
961752125 3:129102936-129102958 TACCATCTATTGGAGAGGCCAGG + Intronic
962974286 3:140432724-140432746 GACTCTCCTGTGGATAAGCCTGG + Intronic
965207796 3:165744135-165744157 TACTCTCCTTTTGAGAGGCAGGG + Intergenic
965613881 3:170573286-170573308 TGGTCTCCTTTGGAGAGTTCTGG - Intronic
965826866 3:172740058-172740080 TACACTCCTTTGCCGAGGTCAGG - Intergenic
967726781 3:192869586-192869608 TACTTTCCTTTGGGAAAGCCAGG - Intronic
969722411 4:8899754-8899776 CACTCTCCTCTGGAGAAGCGGGG + Intergenic
972875995 4:43360934-43360956 AACTCTCCTTTGTAGAGACATGG + Intergenic
982846864 4:160264182-160264204 TACTCTGCTTTTGCCAGGCCAGG + Intergenic
983874064 4:172855847-172855869 TCTTCTTCTTTAGAGAGGCCTGG + Intronic
984348052 4:178557049-178557071 TACACTTCTTTTCAGAGGCCAGG + Intergenic
984426587 4:179595816-179595838 TCCTCTCTTCTGCAGAGGCCAGG + Intergenic
985210622 4:187588889-187588911 TACTCCCCTTTGCAAATGCCGGG - Intergenic
985618441 5:938489-938511 TCCTCTCCTGACGAGAGGCCCGG - Intergenic
986707106 5:10461336-10461358 TATTTTCCTTTAGAGAGGCAAGG - Exonic
987894985 5:23933141-23933163 TAATGTCCTTTGCAGAGACCTGG + Intergenic
988238176 5:28574175-28574197 TACCCACCATTGGAGAGGTCAGG - Intergenic
990242597 5:53831072-53831094 TTCTGTCCTTTGCAAAGGCCTGG + Intergenic
994229570 5:97298085-97298107 TACTGTCCTTGGGCAAGGCCTGG - Intergenic
995748065 5:115424619-115424641 TAGTTTCCTTTGGTGAGGTCTGG - Intergenic
995941843 5:117595176-117595198 CAATCTCCTTTAGAGAAGCCTGG - Intergenic
996177211 5:120373484-120373506 TATTAAACTTTGGAGAGGCCTGG + Intergenic
996522211 5:124439597-124439619 TCCTCTCCATTGTAGATGCCTGG - Intergenic
997526110 5:134554305-134554327 TTCTCACTTCTGGAGAGGCCTGG - Intronic
999975530 5:156908413-156908435 CACTCTCCTTTAGAGAAGCCTGG - Intergenic
1007081600 6:39109134-39109156 GGCTCTCCTTTGGAGTCGCCTGG - Intronic
1007822846 6:44573813-44573835 TACTGTGCCTTGGAGAAGCCTGG - Intergenic
1008044397 6:46836974-46836996 AACTCTTCAGTGGAGAGGCCTGG - Intronic
1011044219 6:83064522-83064544 TACTCTCCTTTGTTTAGGCAAGG - Intronic
1011576366 6:88805169-88805191 CACCCTCCTTTGGAGGGGCTGGG - Intronic
1011917405 6:92524923-92524945 TACTTTTCTTTGGAGAGTCCAGG - Intergenic
1012621799 6:101353819-101353841 TTCTCTACTTGGGAGAGTCCAGG + Intergenic
1012873264 6:104696365-104696387 TACTCTCCTTCAGAGAGGTTAGG + Intergenic
1014100965 6:117511220-117511242 GATACTCCTGTGGAGAGGCCTGG - Intronic
1026187454 7:68092973-68092995 TCCTCTCCTTTGGAGGGACATGG - Intergenic
1026652866 7:72230666-72230688 TACATTCCTTTGGAGATGCTGGG - Intronic
1028336135 7:89658348-89658370 AAGTCACCTTTGGAAAGGCCTGG + Intergenic
1028968261 7:96827353-96827375 TTCTCTCCTCTGGAGTGACCTGG - Intergenic
1030968518 7:116024281-116024303 TTCTCTCCTATGGAGAGGCGAGG + Intronic
1035205694 7:157292750-157292772 TCCTCTCCAGTGAAGAGGCCGGG + Intergenic
1036686317 8:10913990-10914012 GACTCTCCTTTGGTCAGGTCCGG + Intronic
1038157490 8:25003808-25003830 TTCTCTTCTTTAAAGAGGCCAGG - Intergenic
1038179266 8:25211283-25211305 TACTATCTATTGGAGAGGTCAGG + Intronic
1038702193 8:29859237-29859259 AACTCTACCTGGGAGAGGCCTGG + Intergenic
1041986102 8:63923846-63923868 TAATCTTATTTGGAGAGACCTGG + Intergenic
1048013926 8:130481032-130481054 CACCCTCCTTTGAAGAGGGCTGG + Intergenic
1048199302 8:132358597-132358619 TCCTCACCTTTGGAGAGCTCTGG - Intronic
1048710508 8:137205073-137205095 TACTATTCTTTGGGGAGGACAGG + Intergenic
1049161129 8:141098647-141098669 TCTTCTCCTTTGGAGTGGCTGGG + Intergenic
1049679828 8:143913171-143913193 TCCTCTCCTCATGAGAGGCCAGG - Intergenic
1053653200 9:40189957-40189979 AACTCTTCAGTGGAGAGGCCTGG + Intergenic
1053903603 9:42819247-42819269 AACTCTTCAGTGGAGAGGCCTGG + Intergenic
1054531383 9:66186261-66186283 AACTCTTCAGTGGAGAGGCCTGG - Intergenic
1055815214 9:80196889-80196911 TACTCTCCTTTGAAGGGGAGAGG - Intergenic
1058975904 9:110125394-110125416 TAACCTCCTTCGGAGAGGCCTGG - Intronic
1059336834 9:113574433-113574455 TTCTCTGCCTTGGAGATGCCAGG - Intronic
1060649430 9:125312718-125312740 TTCTCACATTTGTAGAGGCCAGG + Intronic
1061546767 9:131309078-131309100 GACTCTCCTCTGGGGAGGCCGGG + Exonic
1187000475 X:15171608-15171630 CATTCTCATATGGAGAGGCCAGG - Intergenic
1187431823 X:19232128-19232150 TACTCACCTCTGTAAAGGCCCGG - Intergenic
1189268396 X:39733675-39733697 TTCTGCCCTTTGGAGAGGTCAGG + Intergenic
1192787334 X:74347972-74347994 TAGTCCTCTTTGGAGAGGTCGGG - Intergenic
1194573133 X:95576933-95576955 TACTCTCCTTTCCAGAGGTGGGG - Intergenic
1195091919 X:101468578-101468600 TACTCTCCTAAGGACAGGCGTGG - Intronic
1200165356 X:154031640-154031662 TGCTGAACTTTGGAGAGGCCTGG - Intronic
1201390461 Y:13491655-13491677 TCCTCTCCTGTGTAGAGGTCTGG + Intergenic