ID: 903063212

View in Genome Browser
Species Human (GRCh38)
Location 1:20684484-20684506
Sequence GAGTGGGTCTCACATTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 97}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903063198_903063212 21 Left 903063198 1:20684440-20684462 CCGGCGGTCCCAGAGAGTGCCTG 0: 1
1: 0
2: 1
3: 11
4: 135
Right 903063212 1:20684484-20684506 GAGTGGGTCTCACATTCAGGAGG 0: 1
1: 1
2: 0
3: 5
4: 97
903063194_903063212 30 Left 903063194 1:20684431-20684453 CCAGCTCCCCCGGCGGTCCCAGA 0: 1
1: 0
2: 0
3: 18
4: 202
Right 903063212 1:20684484-20684506 GAGTGGGTCTCACATTCAGGAGG 0: 1
1: 1
2: 0
3: 5
4: 97
903063196_903063212 23 Left 903063196 1:20684438-20684460 CCCCGGCGGTCCCAGAGAGTGCC 0: 1
1: 0
2: 0
3: 12
4: 96
Right 903063212 1:20684484-20684506 GAGTGGGTCTCACATTCAGGAGG 0: 1
1: 1
2: 0
3: 5
4: 97
903063205_903063212 2 Left 903063205 1:20684459-20684481 CCTGGGGATGGCTTGTCCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 177
Right 903063212 1:20684484-20684506 GAGTGGGTCTCACATTCAGGAGG 0: 1
1: 1
2: 0
3: 5
4: 97
903063197_903063212 22 Left 903063197 1:20684439-20684461 CCCGGCGGTCCCAGAGAGTGCCT 0: 1
1: 0
2: 1
3: 5
4: 107
Right 903063212 1:20684484-20684506 GAGTGGGTCTCACATTCAGGAGG 0: 1
1: 1
2: 0
3: 5
4: 97
903063203_903063212 13 Left 903063203 1:20684448-20684470 CCCAGAGAGTGCCTGGGGATGGC 0: 1
1: 0
2: 2
3: 26
4: 235
Right 903063212 1:20684484-20684506 GAGTGGGTCTCACATTCAGGAGG 0: 1
1: 1
2: 0
3: 5
4: 97
903063195_903063212 24 Left 903063195 1:20684437-20684459 CCCCCGGCGGTCCCAGAGAGTGC 0: 1
1: 0
2: 1
3: 8
4: 79
Right 903063212 1:20684484-20684506 GAGTGGGTCTCACATTCAGGAGG 0: 1
1: 1
2: 0
3: 5
4: 97
903063204_903063212 12 Left 903063204 1:20684449-20684471 CCAGAGAGTGCCTGGGGATGGCT 0: 1
1: 0
2: 2
3: 20
4: 217
Right 903063212 1:20684484-20684506 GAGTGGGTCTCACATTCAGGAGG 0: 1
1: 1
2: 0
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903063212 Original CRISPR GAGTGGGTCTCACATTCAGG AGG Intronic
900998242 1:6134375-6134397 GTGTGGGTCTCATGTTCAGTGGG - Intronic
902573317 1:17360852-17360874 GAGTGGGATTCACCTTCTGGAGG + Intronic
903063212 1:20684484-20684506 GAGTGGGTCTCACATTCAGGAGG + Intronic
903629149 1:24753423-24753445 AAGTGGGGCTCACATTAAGTAGG + Intronic
905344486 1:37302177-37302199 GAGTGGGTGTCACCATAAGGAGG - Intergenic
906282496 1:44563932-44563954 GTGTGGGTCTCTAACTCAGGAGG - Intronic
909489442 1:76209832-76209854 GAGTGGGGCTTAGATTCAGCAGG - Intronic
915335792 1:155140425-155140447 GAGTGGGTCTCAAATATAGAGGG - Intronic
915354084 1:155245300-155245322 CAGTGGGTCTAACACTCAGTAGG - Intergenic
921050627 1:211508888-211508910 GAGTGGGTGGCCCAGTCAGGAGG - Intergenic
921190213 1:212701056-212701078 GAGTGGGTCTTAAATCCTGGCGG - Intergenic
921673520 1:217952029-217952051 GTGTGGGCCTCATCTTCAGGTGG - Intergenic
921796017 1:219345873-219345895 GTGTGAGTATCACATTGAGGGGG - Intergenic
1063201935 10:3792503-3792525 GAGTGTGTCTCAGATACAGTTGG + Intergenic
1065395168 10:25228675-25228697 TAAAGGGGCTCACATTCAGGGGG - Intronic
1067564611 10:47327598-47327620 GATTGGGTCTCACATTCAGGAGG - Intergenic
1080511969 11:32983727-32983749 GAGGTGGTGTCACACTCAGGAGG + Intronic
1081678302 11:44984033-44984055 GGGTGGTTCTCACTTTCATGAGG - Intergenic
1084018678 11:66403632-66403654 AAGTGGGTCTAACAAGCAGGGGG + Intergenic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1090996435 11:131870045-131870067 GAATGGCCCTCACCTTCAGGAGG + Intronic
1092519534 12:9253685-9253707 GGGTGGCTCTCACCTTCAGGCGG + Intergenic
1097690398 12:62729212-62729234 GAGTGGGTCACACACTGAAGAGG + Intronic
1101994075 12:109512121-109512143 AAGGGGGTCTGGCATTCAGGAGG + Intronic
1113373224 13:109741269-109741291 GAGTGGGGCTTAGATTCAGCAGG + Intergenic
1113851279 13:113419876-113419898 AGGTGTGTCTCACATACAGGTGG + Intergenic
1117788107 14:59308765-59308787 CAGTGGCTCTCACATGCAGCAGG - Intronic
1119099632 14:71867965-71867987 AAGTGAGTCTCACATCCATGAGG + Intergenic
1119931639 14:78553405-78553427 GAGTGGGTCTTAAACTCAGTGGG - Intronic
1121239850 14:92421228-92421250 GAGTGTGTCAGACATTCAGTAGG + Intronic
1121259021 14:92552952-92552974 GAGTGGGCCTCTCATTCACTCGG - Intronic
1121622082 14:95357268-95357290 GAGTGGGGCCCACATCCAAGTGG + Intergenic
1125245058 15:37626743-37626765 GAGTTGGTCTCACTTACAGCTGG - Intergenic
1126510940 15:49473576-49473598 GAGTTGGTCTCACGTTTTGGAGG + Intronic
1129476428 15:75787053-75787075 GAGTGGCTCTAACATTCAAATGG - Intergenic
1134193703 16:12142209-12142231 GAGTGGGTCACATATGCAGCAGG - Intronic
1138926040 16:61592599-61592621 GTGTGGGTCACAGATCCAGGTGG - Intergenic
1142032775 16:87846742-87846764 GGGTGGGTCTCAGCTTCAGAGGG - Intronic
1146143678 17:30390785-30390807 GAGTAGGTCTCACAATAACGAGG - Intronic
1146457415 17:33018429-33018451 GAGTGGTTCTCAAACTCTGGTGG - Intronic
1147690815 17:42313242-42313264 GAGGGGGCCTCACACACAGGTGG - Intergenic
1148354748 17:46968384-46968406 GAATGAGTCACACATTCAGTGGG - Intronic
1152525492 17:80886064-80886086 GAGTGTGTCTCCCCGTCAGGTGG + Intronic
1159449110 18:68576979-68577001 CAGTGAGTCTCACCTTCATGGGG - Intergenic
1159555808 18:69943231-69943253 GAGTGGGTCACTCATTTTGGGGG + Intronic
1159605259 18:70468300-70468322 GCCTGGGTCTCACCTTCAGAGGG + Intergenic
1164763513 19:30745613-30745635 GAAGGGGGCTCACATGCAGGAGG + Intergenic
1165153999 19:33776757-33776779 GAGTGGGGCTCCCATCCAGGAGG - Intergenic
1166617174 19:44260571-44260593 GAGTGTGTCTCACCTCCATGTGG + Intronic
1166750754 19:45163044-45163066 AAGTGGGTATCAAATTGAGGTGG - Exonic
932277135 2:70459984-70460006 CAGTGGGTCTCACCTACAGTTGG + Intronic
933514668 2:83285345-83285367 GAGTGAGACTCTCATGCAGGGGG + Intergenic
935265035 2:101386972-101386994 GAGGGGGCCTGGCATTCAGGCGG - Intronic
936269681 2:111040376-111040398 GAGTAGATGTCAGATTCAGGAGG - Intronic
937292159 2:120788223-120788245 CAGTGGTTGTCACATTCAGCTGG - Intronic
939079219 2:137639547-137639569 CAGTGGGTCTACCATTCACGAGG - Intronic
939787919 2:146539410-146539432 AAGTGGGGATCACATTCAGGAGG - Intergenic
940080960 2:149800800-149800822 GAGAGGGTCTGAAATGCAGGTGG - Intergenic
946170094 2:217889995-217890017 CAGTGGGTCACACAACCAGGAGG + Intronic
946356508 2:219189023-219189045 GAGTGGGACTGACATTGGGGTGG - Intergenic
946530422 2:220564378-220564400 GAGAGGGTCTTCCATGCAGGAGG - Intergenic
1176721565 21:10397791-10397813 GGGTGGGACTCACTTCCAGGTGG - Intergenic
1176728088 21:10460198-10460220 GAGTGGTTCTGAGATTCAGTTGG + Intergenic
1179238715 21:39569540-39569562 GAGGGGGTCTCAGATTGAAGGGG - Intronic
1180302755 22:11050566-11050588 GGGTGGGACTCACTTCCAGGTGG - Intergenic
1183320628 22:37163161-37163183 GAGTGGTTCTCAGGTTCTGGAGG + Intronic
953476743 3:43211772-43211794 TCGTGGGGCTCACATTCTGGAGG + Intergenic
957396733 3:79649173-79649195 CAGTGGTTCTCAAATTCAGTTGG - Intronic
957625248 3:82646839-82646861 CAGTGGATCTAACATTCTGGGGG - Intergenic
961627170 3:128272126-128272148 GTGTGGGCCACACACTCAGGTGG + Intronic
962729371 3:138265818-138265840 GAGTGGTTCTTCCATTGAGGAGG + Intronic
969816512 4:9691602-9691624 GAGTGTGGCTCACGTTCGGGAGG - Intergenic
986352175 5:6890889-6890911 GAATGGGTTTCACACTCAAGTGG - Intergenic
989128229 5:38077858-38077880 GAGTTTGTCTCACATTGACGTGG + Intergenic
990518167 5:56550326-56550348 GAGTGGATTCCACATTAAGGGGG + Intronic
997838435 5:137216176-137216198 GAATGGGTGACACATTCAGCAGG + Intronic
1000618973 5:163460951-163460973 CCGTGGGGCTTACATTCAGGCGG + Intronic
1007250985 6:40494800-40494822 GATTGGGGCTCTCAATCAGGTGG - Intronic
1007402884 6:41614505-41614527 TAGTGGCTCTCACCTTCTGGAGG - Intergenic
1012256625 6:97040457-97040479 GAGTGGTTCTCAAATTCAAGTGG + Intronic
1017016053 6:150100361-150100383 GAGTGGTTCTCTAATTTAGGAGG + Intergenic
1019280436 7:197145-197167 AAGGGGGTCTGACATGCAGGAGG - Intronic
1022003922 7:26249899-26249921 GGGTGGTTCTCTCATTTAGGAGG + Intergenic
1026845114 7:73694342-73694364 GAGAGGGTCCCAGATGCAGGTGG - Intronic
1028291522 7:89071222-89071244 GAGTGGGTTCCACATGCATGGGG - Intronic
1034602010 7:152267833-152267855 GAGTGGTTCTGAGATTCAGTTGG - Intronic
1038914738 8:32008282-32008304 CAGTGGATCTCAGATTCAGTGGG - Intronic
1041331122 8:56726053-56726075 GAGTGGTTCTCACAGTGTGGTGG + Intergenic
1043012178 8:74894584-74894606 AAGTGGGTCACACATCCAGAGGG - Intergenic
1043024054 8:75044579-75044601 AAGTGGGGCTCAAACTCAGGTGG + Intergenic
1045016468 8:98005320-98005342 GAGCGGGTCTCCCATTCAACAGG + Intronic
1047762159 8:127962303-127962325 GAGTGGGCCACACATTTAGGGGG + Intergenic
1048442421 8:134469762-134469784 GAGTGCATCTCACCTGCAGGAGG + Intergenic
1048611963 8:136032778-136032800 GGGTGGTTCTCACTTTCAGAAGG + Intergenic
1051179607 9:14396462-14396484 CAGTGGGGCCCAAATTCAGGTGG + Intronic
1057690304 9:97277917-97277939 GTGTGGGCCTCACAGTTAGGTGG + Intergenic
1060211970 9:121716110-121716132 GAGTGGGTCTCAGAATCACCTGG - Intronic
1061621124 9:131811981-131812003 CAGTGGGTCCTACAGTCAGGTGG - Intergenic
1061803322 9:133124743-133124765 GAGAGGGTCTTGCATGCAGGAGG - Intronic
1186709187 X:12174745-12174767 CAATGGGTCTCAAATTCTGGTGG - Intronic
1188961784 X:36501724-36501746 GTATGGATCTCACATTTAGGAGG - Intergenic
1192945763 X:75964405-75964427 GGGTGGTTCTCTAATTCAGGAGG - Intergenic
1201560338 Y:15309624-15309646 CAGTGGGACTCACATTATGGTGG + Intergenic
1202049056 Y:20762128-20762150 GAATGTGTCTCATATTTAGGTGG - Intronic